View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14271_high_40 (Length: 205)
Name: NF14271_high_40
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14271_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 36938967 - 36938796
Alignment:
| Q |
15 |
ttatactcgtctttgaaatcattagctgcgtgtgctaattctgcatatgaatacttcctaggtcctgccccccttccaaaatcctctcccatgtactctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938967 |
ttatactcgtctttgaaatcattagctgcgtgtgctaattctgcatatgtatacttcctaggtcctgccccccttccaaaatcctctcccatgtactctt |
36938868 |
T |
 |
| Q |
115 |
caaattcaccatcttcctcttcactttctttcttccacttcttccacaacacaatggaaaaaagacccaata |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36938867 |
caaattcaccatcttcctcttcactttctttcttccacttcttccacaacacaatggaaaaaagacccaata |
36938796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 15 - 132
Target Start/End: Original strand, 36942151 - 36942268
Alignment:
| Q |
15 |
ttatactcgtctttgaaatcattagctgcgtgtgctaattctgcatatgaatacttcctaggtcctgccccccttccaaaatcctctcccatgtactctt |
114 |
Q |
| |
|
|||| ||| |||||||||| ||||||||| | ||||||||||||||||| ||||||| | ||||||| ||| ||||| ||||| || ||||||||||||| |
|
|
| T |
36942151 |
ttatgctcatctttgaaattattagctgcatttgctaattctgcatatgtatacttcttgggtcctgtccctcttccgaaatcttcacccatgtactctt |
36942250 |
T |
 |
| Q |
115 |
caaattcaccatcttcct |
132 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36942251 |
gaaattcaccatcttcct |
36942268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University