View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14271_low_20 (Length: 337)
Name: NF14271_low_20
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14271_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 33781036 - 33780711
Alignment:
| Q |
1 |
cactttaaattaaaggcgtctctggtatccacatgtgttggtgtcagacacgacaatgacacgtgtgatgatatattattattccatttttgcaaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33781036 |
cactttaaattaaaggcgtctctggtatccacatgtgttggtgtcagacacgacaatgacacgtgtgatgatatattattattccatttttgcaaattat |
33780937 |
T |
 |
| Q |
101 |
tggggctgtctacgtgtcaatgttgtgacctacgtcttgtgtcggtgcttcataggatggaacatgcaacttggttactgtttcaatcatttgtgtttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33780936 |
tggggctgtctacgtgtcaatgttgtgacctacgtcttgtgtcggtgcttcataggatggaacatgcaactttgttactgtttcaatcatttgtgtttca |
33780837 |
T |
 |
| Q |
201 |
aattggaagtgtgttaccaacttattgatctttataggaaaacctgattgtcttacataaaccatgtgcttggtttcaacatagaatgatttcatttgag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33780836 |
aattggaagtgtgttaccaacttattgatctttataggaaaacctgattgtcttacataaaccatgtgcttggtttcaacatagaatgatttcatttgag |
33780737 |
T |
 |
| Q |
301 |
tccttgtcatgtgaccattgtgcttc |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33780736 |
tccttgtcatgtgaccattgtgcttc |
33780711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University