View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14271_low_32 (Length: 239)
Name: NF14271_low_32
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14271_low_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 8390625 - 8390502
Alignment:
| Q |
1 |
catgtcttccgttttcttcgatttttctgtcttctacctaaacagtctatttggttacaacttacaaaactattagtttgatcatttgtgatacttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8390625 |
catgtcttccgttttcttcgatttttctgtcttctacctaaacagtctatttggttacaacttacaaaacaattagtttgatcatttgtgatacttgatt |
8390526 |
T |
|
| Q |
101 |
gatatcaaattcctattatgttta |
124 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
8390525 |
gatatcaaattcctattatcttta |
8390502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 151
Target Start/End: Original strand, 8421491 - 8421548
Alignment:
| Q |
94 |
cttgattgatatcaaattcctattatgtttatgccatgtcaattttcctcttgctgtt |
151 |
Q |
| |
|
|||||||||||| || ||||| ||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
8421491 |
cttgattgatatgaacttcctcttatgttaatgcctcgtcaattttcctcttgttgtt |
8421548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 51
Target Start/End: Original strand, 8421418 - 8421446
Alignment:
| Q |
23 |
ttttctgtcttctacctaaacagtctatt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8421418 |
ttttctgtcttctacctaaacagtctatt |
8421446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University