View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14271_low_42 (Length: 210)

Name: NF14271_low_42
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14271_low_42
NF14271_low_42
[»] chr2 (1 HSPs)
chr2 (38-193)||(6139090-6139245)


Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 38 - 193
Target Start/End: Original strand, 6139090 - 6139245
Alignment:
38 aaaattgaagaggctaccaagagttaaaatcagtactgaactttcaagaactgtcttcatctctctagaacctggatgtaaatgcaaacaactagataaa 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6139090 aaaattgaagaggctaccaagagttaaaatcagtactgaactttcaagaactgtcttcatctctctagaacctggatgtaaatgcaaacaactagataaa 6139189  T
138 tgattgcaagaaagaaaaggcattgactagtgaaatattatacacggttggaatta 193  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
6139190 tgattgaaagaaagaaaaggcattgactagtgaaatattatacacggttggaatta 6139245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University