View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14272_high_3 (Length: 624)
Name: NF14272_high_3
Description: NF14272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14272_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 4e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 4e-98
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 40741788 - 40742004
Alignment:
| Q |
18 |
caaactaggaataccttttcatggatactctttagtggaaggtcttaagttttcatggaaaataaatttattaggaaaatgtcatacccgtgttgctctg |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
40741788 |
caaactaggaataccttttcatgaatactctttagtggaaggtcttaagttttcatggaaaataaatttattagggaaatgtcatacccgtgatgctct- |
40741886 |
T |
|
| Q |
118 |
tcagcttcccaaaggaccacctgtggtatgaaaattggtatatctgcaagtgaaaaatagtgtgcagggatagaatgacaggcctctaactagattattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40741887 |
------tcccaaaggaccacctgtggtatgaaaattggtatatctgcaagtgaaaaatagtgtgcagggataaaatgacaggcctctaactagattattg |
40741980 |
T |
|
| Q |
218 |
tgaaaaataaatctttaggaataa |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40741981 |
tgaaaaataaatctttaggaataa |
40742004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University