View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14272_low_10 (Length: 245)
Name: NF14272_low_10
Description: NF14272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14272_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 47408276 - 47408050
Alignment:
| Q |
1 |
atccaaagatcagtgtgtaaggcttttgaaagggattgtggaggatcagatgattaggaaagcattaacagaagtgcaacaacaggtaggtagagtatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47408276 |
atccaaagatcagtgtgtaaggcttttgaaagggattgtggaggatcagatgattaggaaagcattaacagaagtgcagcaacaggtaggtagagtatgt |
47408177 |
T |
|
| Q |
101 |
ggtttatgtagccttacagatgnnnnnnnnaaggcgattgaatatagatttcaacgttatgctaagaaccattgtttttcttgcagataaaatccaatac |
200 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47408176 |
ggtttatgcagccttacagatgttttttttaaggcgattgaatatagatttcaacgttatgctaagaaccattgtttttcttgcagataaaatccaatac |
47408077 |
T |
|
| Q |
201 |
gggttcttctggacaacagcaccctat |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
47408076 |
gggttcttctggacaacagcaccctat |
47408050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 3 - 94
Target Start/End: Complemental strand, 47419503 - 47419412
Alignment:
| Q |
3 |
ccaaagatcagtgtgtaaggcttttgaaagggattgtggaggatcagatgattaggaaagcattaacagaagtgcaacaacaggtaggtaga |
94 |
Q |
| |
|
||||||| || | |||| ||||| ||||||||||||||| |||||||||| |||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
47419503 |
ccaaagaacattttgtacggcttatgaaagggattgtgggggatcagatgcttaggatagcattagcaaaagtgcaacaacaggtaggtaga |
47419412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 16 - 90
Target Start/End: Complemental strand, 47391127 - 47391053
Alignment:
| Q |
16 |
tgtaaggcttttgaaagggattgtggaggatcagatgattaggaaagcattaacagaagtgcaacaacaggtagg |
90 |
Q |
| |
|
|||| ||||| ||||||||||||||| |||||||||| |||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
47391127 |
tgtacggcttatgaaagggattgtgggggatcagatgcttaggatagcattaacaaaagtgcaacaacaggtagg |
47391053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 144 - 225
Target Start/End: Complemental strand, 47391019 - 47390938
Alignment:
| Q |
144 |
atagatttcaacgttatgctaagaaccattgtttttcttgcagataaaatccaatacgggttcttctggacaacagcaccct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||| |||| ||||||| |||||||||||||| |||| |||| |
|
|
| T |
47391019 |
atagatttcaacgttatgctaagaaccatcctttttattgcagacaaaaaccaatacaggttcttctggacagcagccccct |
47390938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 16 - 94
Target Start/End: Complemental strand, 47421962 - 47421884
Alignment:
| Q |
16 |
tgtaaggcttttgaaagggattgtggaggatcagatgattaggaaagcattaacagaagtgcaacaacaggtaggtaga |
94 |
Q |
| |
|
|||| ||||| ||||||||||||||| ||||| |||| |||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
47421962 |
tgtacggcttatgaaagggattgtgggggatccgatgcttaggatagcattagcaaaagtgcaacaacaggtaggtaga |
47421884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 144 - 225
Target Start/End: Complemental strand, 47421834 - 47421757
Alignment:
| Q |
144 |
atagatttcaacgttatgctaagaaccattgtttttcttgcagataaaatccaatacgggttcttctggacaacagcaccct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| | |||| ||||||| |||||||||||||| |||| |||| |
|
|
| T |
47421834 |
atagatttcaacgttatgctaagaaccatcctttttctt----acaaaaaccaatacaggttcttctggacagcagccccct |
47421757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 212
Target Start/End: Complemental strand, 47419382 - 47419314
Alignment:
| Q |
144 |
atagatttcaacgttatgctaagaaccattgtttttcttgcagataaaatccaatacgggttcttctgg |
212 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||| ||| |||| |||| || ||||||||||| |
|
|
| T |
47419382 |
ataggtttcaacgttatgctaagaaccgtcctttttcttgtagacaaaaaccaacacaggttcttctgg |
47419314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University