View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14272_low_6 (Length: 307)
Name: NF14272_low_6
Description: NF14272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14272_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 142 - 291
Target Start/End: Complemental strand, 4411862 - 4411713
Alignment:
| Q |
142 |
gagctaagcatttaaaaaggcaacattttgggtctaacatggaagcttctggctttaatggctcaaaaataacatcaagtctttgtgccccatgaacttc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411862 |
gagctaagcatttaaaaaggcaacattttgggtctaacatgcaagcttctggctttaatggctcaaaaataacatcaagtctttgtgccccatgaacttc |
4411763 |
T |
 |
| Q |
242 |
caccaggatataattgcaattgcaacaaacaccaacatcaacgtcaacat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4411762 |
caccaggatataattgcaattgcaacaaacaccaacatcaacgacaacat |
4411713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 4412001 - 4411919
Alignment:
| Q |
1 |
attcaagaaaaagactcgttaataagatttgaagaaacacataaaatgttgcaataatcactctttatcatgtgcaaagattg |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412001 |
attcaagaaaaagactcgttaataagatttgaagaaacacgtaaaatgttgcaataatcactctttatcatgtgcaaagattg |
4411919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University