View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_high_27 (Length: 410)
Name: NF14275_high_27
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 185 - 398
Target Start/End: Complemental strand, 273905 - 273692
Alignment:
| Q |
185 |
gagtgggattaattaagtaattaatgaattgatgatgaagtagtagaaagtaactaaccaagatttcaggatcatcaggcaaactttcttcgatgcaaat |
284 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
273905 |
gagtgggattaattaattaattaatgaattgatgatgaagtagtagaaagtaactaaccaagatttcaggatcatcaggcaaactttcttcgatgcaaat |
273806 |
T |
 |
| Q |
285 |
agggacggagagttctaactccttcttcctcttcggcgctcggcttctgactttccgatactctctctttcctcctccgccggctgcacggactacacga |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
273805 |
agggacggagagttctaactccttcttcctcttcggcgctcggcttctgaatttccgatactctctctttcctcctccgccggctgcacggactccacga |
273706 |
T |
 |
| Q |
385 |
aacggttgcagctg |
398 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
273705 |
aacggttgcggctg |
273692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 92
Target Start/End: Complemental strand, 274010 - 273937
Alignment:
| Q |
19 |
aaaggatctagcttctctaaagtaactaattcacatataatccatcaatttatgagaaagaaaataaaaaacta |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
274010 |
aaaggatctagcttctctaaagtaactaattcacatataatccatccatttatgagaaagaaaataaaaaacta |
273937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University