View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_high_63 (Length: 236)
Name: NF14275_high_63
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_high_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 53174843 - 53175049
Alignment:
| Q |
12 |
cagaacctgtggtggatagttcaaaaacaaagtaaagtccattgtcaatacaacatcctagaagagataaaacattggaatgacgaacatgaccaattgt |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174843 |
cagaaccagtggtggatagttcaaaaacaaagtaaagtccattgtcaatacaacatcctagaagagataaaacattggaatgacgaacatgaccaattgt |
53174942 |
T |
 |
| Q |
112 |
tccaatctctgtcaaaaactctttctcttttctttcatcctttgaagctcttgttaatctcttcacagcaatttcttcaccatttttcaatgttcccttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174943 |
tccaatctctgtcaaaaactctttctcttttctttcatcctttgaagctcttgttaatctcttcacagcaatttcttcaccatttttcaatgttcccttg |
53175042 |
T |
 |
| Q |
212 |
taaacct |
218 |
Q |
| |
|
||||||| |
|
|
| T |
53175043 |
taaacct |
53175049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University