View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_low_50 (Length: 291)
Name: NF14275_low_50
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 281
Target Start/End: Original strand, 14021751 - 14022013
Alignment:
| Q |
19 |
cgaactgtggcggaggtggtggatggtgatgatggtgtgtcaacagaaaagggtcaccggcagtaacatctgccgatgactcttttcggtggaagttacg |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021751 |
cgaattgtggcggaggtggtggatggtgatgatggtgtgtcaacagaaaagggtcaccggcagtaacatctgccgatgactcttttcggtggaagttacg |
14021850 |
T |
|
| Q |
119 |
gtggcagttacaagcagcacattttagtgactccaaagttccttcacttcctgccggcataaactcaccgcaaccatcaagagcatgaccaccaatacct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14021851 |
gtggcagttacaagcagcacattttagtgactccaaagttccttcacttcctgccggcataaactcaccgcaaccatcaagagcatgacccccaatacct |
14021950 |
T |
|
| Q |
219 |
acagcatgattcttcagacactctctataccttgctttaccatttccaacaacaccacctatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021951 |
acagcatgattcttcagacactctctataccttgctttaccatttccaacaacaccacctatg |
14022013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 105 - 144
Target Start/End: Original strand, 2494675 - 2494714
Alignment:
| Q |
105 |
cggtggaagttacggtggcagttacaagcagcacatttta |
144 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2494675 |
cggtggaagttacggtggcagccacaagcagcacatttta |
2494714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University