View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14275_low_52 (Length: 279)

Name: NF14275_low_52
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14275_low_52
NF14275_low_52
[»] chr1 (1 HSPs)
chr1 (154-247)||(3401160-3401253)


Alignment Details
Target: chr1 (Bit Score: 82; Significance: 9e-39; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 154 - 247
Target Start/End: Complemental strand, 3401253 - 3401160
Alignment:
154 tttcttactgattataaacaatagagaatatgcatgatctatttgccgttcacttaatttcttaatttaggtaccttgtttactatatttgtca 247  Q
    |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||    
3401253 tttcttactgattataaacaatagagaatatgcatgatctattttccattcacttaatttcttaatttaggtaccttgtttactacatttgtca 3401160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University