View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_low_52 (Length: 279)
Name: NF14275_low_52
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 9e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 154 - 247
Target Start/End: Complemental strand, 3401253 - 3401160
Alignment:
| Q |
154 |
tttcttactgattataaacaatagagaatatgcatgatctatttgccgttcacttaatttcttaatttaggtaccttgtttactatatttgtca |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3401253 |
tttcttactgattataaacaatagagaatatgcatgatctattttccattcacttaatttcttaatttaggtaccttgtttactacatttgtca |
3401160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University