View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_low_55 (Length: 271)
Name: NF14275_low_55
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 124 - 255
Target Start/End: Original strand, 45760626 - 45760757
Alignment:
| Q |
124 |
gctatatcaaacacaaactaaaatgaacttacaaataaaactaaaatgaacaacaagttgcgcttatattttattaagtggggtgtctcacctacttaca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45760626 |
gctatatcaaacacaaactaaaatgaacttacaaataaaactaaaatgaacaacaagttgcgcttatattttattaagtggggtatctcacctacttaca |
45760725 |
T |
|
| Q |
224 |
ttagtaatatgctagatagtgcccaaaataat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45760726 |
ttagtaatatgctagatagtgcccaaaataat |
45760757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 13 - 56
Target Start/End: Original strand, 45760515 - 45760558
Alignment:
| Q |
13 |
aaaatctctcatctcccttcctatttttcaaaccaaacagaccc |
56 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
45760515 |
aaaatctctcatctcccttcctattttataaaccaaacaaaccc |
45760558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University