View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_low_56 (Length: 269)
Name: NF14275_low_56
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 32699243 - 32699033
Alignment:
| Q |
20 |
tgctcactagataaaattgtgaaggaaatctaaatttattatgtcaatgccaacgattaattgtattatattttagtcatgttcaatgcacccagcactc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32699243 |
tgctcactagataaaattgtgaaggaaatctaaatttattatgtcaatgccaacgattaattgtattatattttagtcatgttcaatgcacccagcactc |
32699144 |
T |
 |
| Q |
120 |
atctatgacatagatgctcagctataacattacatctttaccatgacatggttgaataatacagtagaaaagagaaatttgttcaaaattcaaagtcaag |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32699143 |
atctatgacatagctgctcagctataacattacatctttaccatgacatggttgaataatacagtagaaaagagaaatttgttcaaaattcaaagtcaag |
32699044 |
T |
 |
| Q |
220 |
aatcagaccaa |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
32699043 |
aatcagaccaa |
32699033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University