View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_low_59 (Length: 263)
Name: NF14275_low_59
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_low_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 247
Target Start/End: Complemental strand, 41300373 - 41300135
Alignment:
| Q |
10 |
gcataggcaggggatgaggcggcctagggccaatgctcataggggagccaaattttttatggagagggtgtatatagtaatacttgatttaaagcggata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41300373 |
gcataggcaggggatgaggcggcctagggccaatgctcataggggagccaaattttttatggaaagggtgtatatagtaatacttgatttaaagcggata |
41300274 |
T |
 |
| Q |
110 |
tatatagcaataagcgctaggaaaacccaaacatttaccagatttcagcccatcaaccgcttca-cnnnnnnnnacaacatagcagcatttcatatttac |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
41300273 |
tatatagcaataagcgccaggaaaacccaaacatttaccagatttcagcccatcaaccgcttcaccttttttttacaacatagcagcatttcatctttac |
41300174 |
T |
 |
| Q |
209 |
acccgaaagtcagtactttcattttcactcccaacattt |
247 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
41300173 |
accccaaagtcagtgctttcattttcactcccaacattt |
41300135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 75 - 174
Target Start/End: Complemental strand, 22855429 - 22855328
Alignment:
| Q |
75 |
gggtgtatatagtaatacttgatttaaagcgg--atatatatagcaataagcgctaggaaaacccaaacatttaccagatttcagcccatcaaccgcttc |
172 |
Q |
| |
|
||||||||||||||||||||| ||||||| || |||||||||||||||||||| | || | ||||||||||||| ||| |||||||||||||||| ||| |
|
|
| T |
22855429 |
gggtgtatatagtaatacttggtttaaagtgggtatatatatagcaataagcgcaaagagagcccaaacatttactagagttcagcccatcaaccgtttc |
22855330 |
T |
 |
| Q |
173 |
ac |
174 |
Q |
| |
|
|| |
|
|
| T |
22855329 |
ac |
22855328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University