View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_low_66 (Length: 235)
Name: NF14275_low_66
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 25869227 - 25869011
Alignment:
| Q |
1 |
ttgtctagtgtagatttgatcaatgtcgatcggtttgtggaccgggtgattgagttatctggttacagaagaggtttgtatgattccctgaccactaaaa |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||| |||||||||||| ||||||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
25869227 |
ttgtctagtgtagagttgatcaatgtcgatcagtttgtggaacgggtgattgagctatctggttacggaagagagttgtatgattacctgaccactaaaa |
25869128 |
T |
 |
| Q |
101 |
tggactgtgatatttcaaaattgttcaagatgttgatggtggttgtttaattttccatgatatagataagtggcagatttatgtaaaaccgccacggcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25869127 |
tggactgtgatatttcaaaattgttcaagatgttgatggtggttgtttgattttccatgatatagataagtggcagatttatgtaaaaccgccacggcca |
25869028 |
T |
 |
| Q |
201 |
atttttaacagacggcg |
217 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
25869027 |
atttttaacagatggcg |
25869011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University