View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_low_67 (Length: 232)
Name: NF14275_low_67
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_low_67 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 14022379 - 14022148
Alignment:
| Q |
1 |
atatcaaatgaagattaaaattttcctttgaacnnnnnnnnngcacatagagaaaaagagtgaaagtgagagtgaatgttcctttgttttctttcttctt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14022379 |
atatcaaatgaagattgaaattttcctttgaacaaaaaaaaagcacatagagaaaaagagtgaaagtgagagtgaatgttcctttgttttctttcttctt |
14022280 |
T |
|
| Q |
101 |
tcagctcaaattattattcactacatcaaagcaaccattgataacctaacttcaaattttgctacaaaaatggattttgatgaagatcaagaagaggaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14022279 |
tcagctcaaattattattcactacatcaaagcaaccattgataacctaacttcaaattttgctacaaaaatggattttgatgaagatcaagaagaggaac |
14022180 |
T |
|
| Q |
201 |
aagatgaagagttatgtatgggtggaggaaat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14022179 |
aagatgaagagttatgtatgggtggaggaaat |
14022148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University