View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14275_low_72 (Length: 206)
Name: NF14275_low_72
Description: NF14275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14275_low_72 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 5e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 13929983 - 13929861
Alignment:
| Q |
1 |
ctttatccgcctgttgagccggaggcccatcattggcagttaggcccgtattttgaacatagtatagtgggaaggatatattttggcccaaaatgtgaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13929983 |
ctttatccgcctgttgagccggaggcccatcattggcagttaggcccgtattttgaacatagtatagtgggaaggatatattttggcccaaaatgtggac |
13929884 |
T |
|
| Q |
101 |
gactatccatgtttggattgctc |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13929883 |
gactatccatgtttggattgctc |
13929861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 152 - 206
Target Start/End: Complemental strand, 14044187 - 14044133
Alignment:
| Q |
152 |
ttgaatatgagagtacaacagttgcaattccaaaaattgaacatcatgcaaagtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| ||| |||||| |
|
|
| T |
14044187 |
ttgaatatgagagtacaacagttgcaatttcaaaaattgaacatgatgtaaagtt |
14044133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 158 - 191
Target Start/End: Complemental strand, 14081514 - 14081481
Alignment:
| Q |
158 |
atgagagtacaacagttgcaattccaaaaattga |
191 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
14081514 |
atgagagcacaacagttgcaattccaaaaattga |
14081481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 6 - 62
Target Start/End: Original strand, 32671592 - 32671648
Alignment:
| Q |
6 |
tccgcctgttgagccggaggcccatcattggcagttaggcccgtattttgaacatag |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
32671592 |
tccgcctgttgagccggaggcccatcattggcagtcaggcccgtattttgaaaatag |
32671648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University