View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14276_low_6 (Length: 215)
Name: NF14276_low_6
Description: NF14276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14276_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 51 - 204
Target Start/End: Original strand, 7131384 - 7131537
Alignment:
| Q |
51 |
tttttctttttcatt-gtcaattgtcatcaccattaaattccacttgtatattatttttctttcaaaaagcttccctccccaactcgaattcaaccctat |
149 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7131384 |
tttttctttttcatttgtcaattgtcatcaccattaaattccacttgtatattatttttctttcaaaaagcttccctccccaactcgaattcaaccctat |
7131483 |
T |
|
| Q |
150 |
caagaacaaatgctctcttatctatagacatgatcgactattcattgtttttcat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7131484 |
caagaacaaatgctctcttatctatagacatgat-gactattcattgtttttcat |
7131537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University