View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14277_high_12 (Length: 249)

Name: NF14277_high_12
Description: NF14277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14277_high_12
NF14277_high_12
[»] chr1 (1 HSPs)
chr1 (12-40)||(48698441-48698469)


Alignment Details
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 40
Target Start/End: Original strand, 48698441 - 48698469
Alignment:
12 aatgaatgaatgttgacaatacaattgta 40  Q
    |||||||||||||||||||||||||||||    
48698441 aatgaatgaatgttgacaatacaattgta 48698469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University