View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14277_high_5 (Length: 394)
Name: NF14277_high_5
Description: NF14277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14277_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Complemental strand, 43195091 - 43194716
Alignment:
| Q |
1 |
accaccttccttgtgacgctgacggtgtatgcatggtctgcaaacaaaaaccatcagaaaccgaaacacttcattgcaaaacctgcacaacaccatggca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195091 |
accaccttccttgtgacgctgacggtgtatgcatggtttgcaaacaaaaaccatcagaaaccgaaacacttcattgcaaaacctgcacaacaccatggca |
43194992 |
T |
 |
| Q |
101 |
tgctccttgtctccctgttgttccaacaacaagtgaaatgctcgattggttgtgtcctgattgtgctcaaccaagtgatgttgttgctgcttctgctgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194991 |
tgctccttgtctccctgttgttccaacaacaagtgaaatgctcgattggttgtgtcctgattgtgctcaaccaagtgatgttgttgctgcttctgctgct |
43194892 |
T |
 |
| Q |
201 |
ccgtctgttgcgggggatcttgtctctgctattcgcgctatcgagaatgatccttcgttgacggaggaagagaagagaaagaaacgccaagagttacatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194891 |
ccgtctgttgcgggggatcttgtctctgctattcgcgctatcgagaatgatccttcgttgacggaggaagagaagagaaagaaacgccaagagttacatg |
43194792 |
T |
 |
| Q |
301 |
gtggatctttgaaagagaaggatgaggttcatgttaggagaagtggtgttcttgatatctttgatgggagtcttaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43194791 |
gtggatctttgaaagagaaggatgaggttcatgttaggagaagtggtgttcttgatatctttgatgggagtcttaa |
43194716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University