View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14278_high_17 (Length: 227)
Name: NF14278_high_17
Description: NF14278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14278_high_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 17273640 - 17273856
Alignment:
| Q |
7 |
tttatttggtttctttgctacaaataccaagtaatattccataatgttttgttttggtgtgcttctcatggatatttaaatatcacattaaagtattttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17273640 |
tttatttggtttctttgctacaaataccaagtaatattccataatgttttgttttggtgtgcttctcatggatatttaaatatcacattaaagt----tt |
17273735 |
T |
 |
| Q |
107 |
tgcatcaacttgttattagtggtgtaaattaacaagttgctctttaatgtgtattggataagtttttagttataattagtaagttattagaagatttgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17273736 |
tgcatcaacttgttattagtggtgtaaattaacaagttgctctttaatgtgtattggataagtttttagttataattagtaagttatttgaagatttgtt |
17273835 |
T |
 |
| Q |
207 |
aaattatacaattaaattttt |
227 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
17273836 |
aacttatacaattaaattttt |
17273856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University