View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14278_high_19 (Length: 209)
Name: NF14278_high_19
Description: NF14278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14278_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 22 - 151
Target Start/End: Complemental strand, 21625277 - 21625148
Alignment:
| Q |
22 |
aaaatggtttaattaacactattactcaatgtctcgttttagaagcaatttttaggggaaaaaatatctctaaataaaaatacatttttaaattactaca |
121 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21625277 |
aaaacggttttattaacactattactcaatgtctcgttttacaagcaatttttaggggaaaaaatatctctaaataaaaatacatttttaaattactaca |
21625178 |
T |
 |
| Q |
122 |
ttcatttggtaaacattaaaatggtttgaa |
151 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
21625177 |
ttcatttggtaaacattaaaatgatttgaa |
21625148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University