View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14278_low_15 (Length: 242)
Name: NF14278_low_15
Description: NF14278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14278_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 225
Target Start/End: Original strand, 1951054 - 1951267
Alignment:
| Q |
11 |
cgaagaatatgatgcacgtagtctttgacaaacggtcaaaagaaccttgagcttgaatacaaactcaacatacggatagctctgactagaaccaacttcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951054 |
cgaagaatatgatgcacgtagtctttgacaaacggtcaaaagaaccttgagcttgaatacaaactcaacatacggatagctctgactagaaccaacttcc |
1951153 |
T |
|
| Q |
111 |
aataactacaatgcttcagatgcatctcattcaacgatgaactatttcattttccctaaaatattttatgaatgttttcttcaatttatgtgtaaaaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1951154 |
aataactacaatgcttcagatgcatctcattcaacgatgaactatttcattttccctaaaatattttatgaatgttttcttcaatttatgtgtaaaaaaa |
1951253 |
T |
|
| Q |
211 |
tatattaaacgaagc |
225 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1951254 |
-atattaaacgaagc |
1951267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University