View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14278_low_16 (Length: 241)
Name: NF14278_low_16
Description: NF14278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14278_low_16 |
 | |
|
| [»] scaffold0252 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0252 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 9334 - 9447
Alignment:
| Q |
1 |
caacttatgaatgtaatgaggtgcaaaagtcacgcttcaccatcgtga--taatccaataaacctgattgtattgggttacgatcgggttgaactattca |
98 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9334 |
caacttatgaatgcaatgaggtgcaaaagtcacgcttcaccatcgtgagctaatccaataaacctg----tattgggttacgatcgggttgaactattca |
9429 |
T |
|
| Q |
99 |
atccactaaatttttaac |
116 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9430 |
atccactaaatttttaac |
9447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University