View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1427_low_10 (Length: 237)
Name: NF1427_low_10
Description: NF1427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1427_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 50975338 - 50975111
Alignment:
| Q |
1 |
ttacacgacaactttcaaaccatatatgcgaaacaaagtttgccgatgttccttcacggacacgctgttttttgttgacttcacacaagcagggtcggca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50975338 |
ttacacgacaactttcaaaccatatatgcgaaacaaagattgccgatgttccttcacggacacgctgttttttgttgacttcacacaagcagggtcggca |
50975239 |
T |
 |
| Q |
101 |
tgataattgttccttcacagatagatacac-tgacaattctatttatagttttattcatac------tatcagggtctctgagttaataatagcccccaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50975238 |
tgataattgttccttcacagatagatacacttgacaattctatttatagttttattcatactatcagtatcagggtctctgagttaataatagcccccaa |
50975139 |
T |
 |
| Q |
194 |
gtcaaaatgagttgacgtggcaaatttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
50975138 |
gtcaaaatgagttgacgtggcaaatttt |
50975111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University