View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1427_low_11 (Length: 236)
Name: NF1427_low_11
Description: NF1427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1427_low_11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 29166377 - 29166157
Alignment:
| Q |
16 |
aaaagagttggttttatagtgtttctaatgcatgtcagatacaatagtttcagtcattcttctttttgttgatggcaacatttcatgtcattttgcttag |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29166377 |
aaaagagttggttttatagtgtatctaatgcatctcagatacaatagtttgagtcattcttctttttgttgatggcaacatttcatgtcattttgcttag |
29166278 |
T |
|
| Q |
116 |
tatcaacatcaaaatggaaggaagaaaagaagattcattaaaattctaaaacgacaaatatcttttaacagacatcacgtggcatgtcttaaggtactta |
215 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29166277 |
tatcaatatcaaaatggaaggaagaaaagaagattcattaaaattctaaaacgacaaatatcttttaacagacatcacgtggcatgtcttaaggtactta |
29166178 |
T |
|
| Q |
216 |
catgtggaactaaagccgccc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29166177 |
catgtggaactaaagccgccc |
29166157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University