View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1427_low_7 (Length: 242)
Name: NF1427_low_7
Description: NF1427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1427_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 21 - 220
Target Start/End: Original strand, 47159891 - 47160091
Alignment:
| Q |
21 |
gagtgacaatctagaaattttagcttatggggtccaggctatttatcataaatatttatgcaaaaacatacatgaatcattaatgataaaacgacgacac |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47159891 |
gagtgacaatctagaaattttagcttatggggtccaggctatttatcataaatatttatgcaaaaacatacatgaatcattaatgataaaacgacgacat |
47159990 |
T |
 |
| Q |
121 |
tgtcataattaagcaaaataatttgaagaatataaatttattgaattgtttatcc-nnnnnnnnnnttgtagacaccttaacatctatgaaatacccctt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47159991 |
tgtcataattaagcaaaataatttgaagaatataaatttattgaattgtttatccaaaaaaaaaaattgtagacaccttaacatctatgaaatacccctt |
47160090 |
T |
 |
| Q |
220 |
c |
220 |
Q |
| |
|
| |
|
|
| T |
47160091 |
c |
47160091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 97
Target Start/End: Complemental strand, 3806852 - 3806816
Alignment:
| Q |
61 |
atttatcataaatatttatgcaaaaacatacatgaat |
97 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
3806852 |
atttatcataaatatttatgctaaaacatatatgaat |
3806816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University