View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14282_high_25 (Length: 310)
Name: NF14282_high_25
Description: NF14282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14282_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 20784674 - 20784402
Alignment:
| Q |
1 |
caaagggtgttttttctactgacctgaggggtcaatatttataggcgtccatttcctaaagttttggggaaattggttcacgatgtgtccgatagctggc |
100 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |||| |
|
|
| T |
20784674 |
caaaaggtgttttttctattgacctgaggggtcaatatttataggcgtccatttcctaaagttttggggaaattggttcacgatgcggccgatagatggc |
20784575 |
T |
 |
| Q |
101 |
aatgcaagctaggctttgagctcattctcttttaacttaatcgctttatctcgcgatgcgtggttcataacctgcgatgctagatagacagtagcaatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
20784574 |
aatgcaagctaggctttgagctcattctcttttgacttaatcactttatctcgcgatgcgtggctcatagcctgcgatgttagatagacagtagcaatca |
20784475 |
T |
 |
| Q |
201 |
taaaggattcctttcattctcacgatgcgggactcatggcccatgatgcaagttaggtaatagttgctccttg |
273 |
Q |
| |
|
||||||||||| ||||||||| ||||||| |||||||||||||||||||||||||| || ||| ||||||||| |
|
|
| T |
20784474 |
taaaggattcccttcattctcgcgatgcgagactcatggcccatgatgcaagttagatagtagctgctccttg |
20784402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 85
Target Start/End: Original strand, 10248496 - 10248549
Alignment:
| Q |
32 |
tcaatatttataggcgtccatttcctaaagttttggggaaattggttcacgatg |
85 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||| |||||||||| ||||||| |
|
|
| T |
10248496 |
tcaatatttataggtgtgcatttccttaagtttttgggaaattggcacacgatg |
10248549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University