View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14282_high_38 (Length: 242)
Name: NF14282_high_38
Description: NF14282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14282_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 90 - 225
Target Start/End: Complemental strand, 6264897 - 6264760
Alignment:
| Q |
90 |
atgtttacgtgttggtatcgatatcatgtctaatatcagtgtctatgtgagtgcttaacacacattattgtttgacgcttaaca--tttcattttcaaat |
187 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| || |
|
|
| T |
6264897 |
atgtttacgtgttggtatcgatatcgtgtctaatatcagtgtctatgtgagtgcttaacacacattattgtttgatgcttaacactatttattttcatat |
6264798 |
T |
 |
| Q |
188 |
gtgaatcaggtcatgacttgtagaccacgctcggatct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6264797 |
ttgaatcaggtcatgacttgtagaccacgctcggatct |
6264760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 6264986 - 6264931
Alignment:
| Q |
1 |
tcttttgtatgaagaaaacacagttggcaaggatgaaatcaccttatgtgttcgac |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6264986 |
tcttttgtatgaagaaaacacagttggcaaggatgaaatcaccttgtgtattcgac |
6264931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 225
Target Start/End: Complemental strand, 23782632 - 23782591
Alignment:
| Q |
184 |
aaatgtgaatcaggtcatgacttgtagaccacgctcggatct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
23782632 |
aaatgtgaatcaggtcatgacttgtcgaccacgctcagatct |
23782591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University