View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14282_low_38 (Length: 243)
Name: NF14282_low_38
Description: NF14282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14282_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 17 - 183
Target Start/End: Original strand, 41715826 - 41715992
Alignment:
| Q |
17 |
gatccaatatttctatcctagctaatgactttgtgaacatggctgtatggatagtcttcttttgggtgaacaacgggcatgtgggatataacttaaggag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41715826 |
gatccaatatttctatcctagctaatgactttgtgaacatggctgtatggatagtcttcttttgggtgaacaacgggcatgtgggatataacttaaggag |
41715925 |
T |
|
| Q |
117 |
tgtatttgttcaaagttttggagttgaaaggtgaaaagacattaattttcttcataattcattcatt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
41715926 |
tgtatttgttcaaagttttggagttgaaaggtgaaaagccattaatcttcttcataattcattcatt |
41715992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University