View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14282_low_39 (Length: 242)

Name: NF14282_low_39
Description: NF14282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14282_low_39
NF14282_low_39
[»] chr4 (2 HSPs)
chr4 (90-225)||(6264760-6264897)
chr4 (1-56)||(6264931-6264986)
[»] chr7 (1 HSPs)
chr7 (184-225)||(23782591-23782632)


Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 90 - 225
Target Start/End: Complemental strand, 6264897 - 6264760
Alignment:
90 atgtttacgtgttggtatcgatatcatgtctaatatcagtgtctatgtgagtgcttaacacacattattgtttgacgcttaaca--tttcattttcaaat 187  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||   || ||||||| ||    
6264897 atgtttacgtgttggtatcgatatcgtgtctaatatcagtgtctatgtgagtgcttaacacacattattgtttgatgcttaacactatttattttcatat 6264798  T
188 gtgaatcaggtcatgacttgtagaccacgctcggatct 225  Q
     |||||||||||||||||||||||||||||||||||||    
6264797 ttgaatcaggtcatgacttgtagaccacgctcggatct 6264760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 6264986 - 6264931
Alignment:
1 tcttttgtatgaagaaaacacagttggcaaggatgaaatcaccttatgtgttcgac 56  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||    
6264986 tcttttgtatgaagaaaacacagttggcaaggatgaaatcaccttgtgtattcgac 6264931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 225
Target Start/End: Complemental strand, 23782632 - 23782591
Alignment:
184 aaatgtgaatcaggtcatgacttgtagaccacgctcggatct 225  Q
    ||||||||||||||||||||||||| |||||||||| |||||    
23782632 aaatgtgaatcaggtcatgacttgtcgaccacgctcagatct 23782591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University