View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14282_low_41 (Length: 235)
Name: NF14282_low_41
Description: NF14282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14282_low_41 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 24 - 170
Target Start/End: Complemental strand, 3947167 - 3947021
Alignment:
| Q |
24 |
catgttattggtgtgcatgactttgtggagagagaaaaatttgaaacatagaagaaaacataacatagaaattacagacataagaaaataatagtcaaac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3947167 |
catgttattggtgtgcatgactttgtggagagagaaaaatttgaaacatagaagaaaacatgacatagaaattacagacataagaaaataatagtcaaac |
3947068 |
T |
 |
| Q |
124 |
ataaccggtggctccggtcaacggttgataaacctctttctaaattg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3947067 |
ataaccggtggctccggtcaacggttgataaacctctttctaaattg |
3947021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 189 - 223
Target Start/End: Complemental strand, 3947002 - 3946968
Alignment:
| Q |
189 |
tgctgaagcattcaattttgtggaggagcttcttg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3947002 |
tgctgaagcattcaattttgtggaggagcttcttg |
3946968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University