View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14282_low_44 (Length: 202)
Name: NF14282_low_44
Description: NF14282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14282_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 136
Target Start/End: Original strand, 24239537 - 24239647
Alignment:
| Q |
18 |
tttatttatctatatatacatgtggtgcttgtgtgtattcattcataatcataaccaaagttcttcctcctcccataacaaaagcttcattccctcacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24239537 |
tttatttatctatatatacatgtggtgcttgtgt--------tcataatcataaccaaagttcttcctcctcccataacaaaagcttcattccctcacaa |
24239628 |
T |
 |
| Q |
118 |
cccttaatctttcttctgc |
136 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24239629 |
cccttaatctttcttctgc |
24239647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University