View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14283_high_21 (Length: 202)
Name: NF14283_high_21
Description: NF14283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14283_high_21 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0011 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 12 - 187
Target Start/End: Original strand, 17273 - 17448
Alignment:
| Q |
12 |
tgataagaaagagggattaattcaacccataaaatggtcatctgaacttttgttgcttgcaatctctaaatatagtccattcacttatggcctttcaaga |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17273 |
tgatatgaaagagggattaattcaacccataaaatggtcatctgaacttttgttacttgcaatctctaaatatagtccattcacttatggcctttcaaga |
17372 |
T |
 |
| Q |
112 |
ttgcctactattcattgtttaactttttgttacttggtaagcacaacccaatttgcaacagcctacatcttatatg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
17373 |
ttgcctactattcattgtttaactttttgttacttagtaagcacaacccaatttgcaacagcctatatcctatatg |
17448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 51 - 147
Target Start/End: Complemental strand, 16381977 - 16381881
Alignment:
| Q |
51 |
atctgaacttttgttgcttgcaatctctaaatatagtccattcacttatggcctttcaagattgcctactattcattgtttaactttttgttacttg |
147 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| |||||| ||||| |
|
|
| T |
16381977 |
atctgaacttttgttgtttgcaatatctaaatatagtccattcacttatgggatttcaagattgcctattgttcattgtttaaccttttgtcacttg |
16381881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 41 - 146
Target Start/End: Complemental strand, 17579547 - 17579442
Alignment:
| Q |
41 |
taaaatggtcatctgaacttttgttgcttgcaatctctaaatatagtccattcacttatggcctttcaagattgcctactattcattgtttaactttttg |
140 |
Q |
| |
|
|||| ||| |||||||||||| ||||||| ||||||||| ||||| |||||||||||||| ||||||||||||| | |||||||||| |||| ||||| |
|
|
| T |
17579547 |
taaagtggacatctgaactttgcttgcttggaatctctaagtatagcccattcacttatgggatttcaagattgcccattattcattgtctaaccttttg |
17579448 |
T |
 |
| Q |
141 |
ttactt |
146 |
Q |
| |
|
||||| |
|
|
| T |
17579447 |
ctactt |
17579442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University