View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14283_low_14 (Length: 323)
Name: NF14283_low_14
Description: NF14283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14283_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 101 - 311
Target Start/End: Original strand, 6583522 - 6583734
Alignment:
| Q |
101 |
ttaacctttgtattgttcagttcagtgaagaagctattgccgggaaagttcaaaatttcgaaaattttcagtgaaacagagattaataaagagtttaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6583522 |
ttaacctttgtattgttcagttcagtgaagaagctattgccgggaaagttcaaaatttcgaaaattttcagtgaaaaagagattaataaagagtttaatt |
6583621 |
T |
 |
| Q |
201 |
gttgtat---ttatatacataattcttttgtaaccaaaagaaaatattaacataattctttgggttgggttatattttttgggctattatataaagattt |
297 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6583622 |
gttgtatttattatatatataattcttttgtaaccaagagaaaatattaacataattctttgggttgggttatattttttgggctatta-ataaagattt |
6583720 |
T |
 |
| Q |
298 |
gtgctagttatacc |
311 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6583721 |
gtgctagttatacc |
6583734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 6583429 - 6583498
Alignment:
| Q |
16 |
ggagaaattgaagtgaacgaaaccctaacagagtagaaggattcggttatgagctgaaaatcgaaaccct |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
6583429 |
ggagaaattgaagtgaacgaaaccctaacagagtggagggattcggttatgagctgaaaatcgaaaccct |
6583498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University