View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14283_low_19 (Length: 257)
Name: NF14283_low_19
Description: NF14283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14283_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 8 - 190
Target Start/End: Original strand, 32601184 - 32601367
Alignment:
| Q |
8 |
attatactttgagaacagaaaaagttaaggttacaaaataaaagtaaaaccacttaggaaggtaaattgaaatagattttcacaccgcagaaaatctttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32601184 |
attatactttgagaacagaaaaagttaaggttacaaaataaaagtaaaaccacttaggaaggtaaattgaaatagattttcacaccgcagaaaatctttc |
32601283 |
T |
|
| Q |
108 |
ataacctctagcagataggaaaaattgatatataaactattcttattctta-aaaaacttcatcatcatgcttgtgttggaaca |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32601284 |
ataacctctagcagataggaaaaattgatatataaactattcttattcttataaaaacttcatcatcatgcttgtgttggaaca |
32601367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University