View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14283_low_5 (Length: 542)

Name: NF14283_low_5
Description: NF14283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14283_low_5
NF14283_low_5
[»] chr2 (1 HSPs)
chr2 (17-120)||(17902254-17902357)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 17 - 120
Target Start/End: Complemental strand, 17902357 - 17902254
Alignment:
17 attttgttcatcaattatctttctaaatgggattgcatgttaaggttgtcttgattattttgttttttgctaaaaaatattgcacggatttagaaaaata 116  Q
    ||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
17902357 attttcttcatcaattctctttctaaatgggattgcatgttaaggttgtcttgattattttgttttttgctaaaaaatattgcatggatttagaaaaata 17902258  T
117 ctgt 120  Q
    ||||    
17902257 ctgt 17902254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University