View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14283_low_5 (Length: 542)
Name: NF14283_low_5
Description: NF14283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14283_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 17 - 120
Target Start/End: Complemental strand, 17902357 - 17902254
Alignment:
| Q |
17 |
attttgttcatcaattatctttctaaatgggattgcatgttaaggttgtcttgattattttgttttttgctaaaaaatattgcacggatttagaaaaata |
116 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17902357 |
attttcttcatcaattctctttctaaatgggattgcatgttaaggttgtcttgattattttgttttttgctaaaaaatattgcatggatttagaaaaata |
17902258 |
T |
 |
| Q |
117 |
ctgt |
120 |
Q |
| |
|
|||| |
|
|
| T |
17902257 |
ctgt |
17902254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University