View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14284_high_4 (Length: 226)
Name: NF14284_high_4
Description: NF14284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14284_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 56165895 - 56165686
Alignment:
| Q |
11 |
aagcaagaaaggaaagttgattgatagcaggaaactcacaccagaagcctcacttcatgcagctcaaaacgaacggttacctgcagtgagagctgttatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56165895 |
aagcaagaaaggaaagttgattgatagcaggaaactcacaccagaagcctcacttcatgcagctcaaaacgaacggttgcctgcagtgagagctgttatt |
56165796 |
T |
 |
| Q |
111 |
caatttctctacactgaacaaacaaacctcaaccgccacgttgattggagtgcttctttcagtagcttgaggagtccaagtgtatatgatggtatgtttg |
210 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
56165795 |
caatttctctactctgaacaaacgaaactcaaccgccacattgattggagtgcttctttcagtagcttgaggagtccaagtgtatatgatggtgtgtttg |
56165696 |
T |
 |
| Q |
211 |
accaaccagc |
220 |
Q |
| |
|
||| |||||| |
|
|
| T |
56165695 |
accgaccagc |
56165686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 37 - 85
Target Start/End: Original strand, 2837311 - 2837359
Alignment:
| Q |
37 |
gcaggaaactcacaccagaagcctcacttcatgcagctcaaaacgaacg |
85 |
Q |
| |
|
|||||||||| |||| |||||| |||||||||||||| ||||||||||| |
|
|
| T |
2837311 |
gcaggaaactaacacaagaagcatcacttcatgcagcacaaaacgaacg |
2837359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 26 - 213
Target Start/End: Complemental strand, 44264135 - 44263951
Alignment:
| Q |
26 |
gttgattgatagcaggaaactcacaccagaagcctcacttcatgcagctcaaaacgaacggttacctgcagtgagagctgttattcaatttctctacact |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||| | | |
|
|
| T |
44264135 |
gttgattgatagcaggaaactcacaccagaagcctcacttcatgcagctcaaaacgaacggttgcctg---tgagagctgttattcaagttctcttctcc |
44264039 |
T |
 |
| Q |
126 |
gaacaaacaaacctcaaccgccacgttgattggagtgcttctttcagtagcttgaggagtccaagtgtatatgatggtatgtttgacc |
213 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| | |||| |||| |||| |
|
|
| T |
44264038 |
gaacaaacgaaactcaaccgtcacgttgattggagtgcttctttcagtagcttgaggagtccaagtggatacggtggtgtgttggacc |
44263951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University