View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_high_19 (Length: 299)
Name: NF14285_high_19
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 38752765 - 38752475
Alignment:
| Q |
1 |
tgactggttctggttctccttgtggagcctgcaaattcttgaggagaaaatgtgttagaggttgtgtttttgcaccttacttttgccatgaacaaggtgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38752765 |
tgactggttctggttctccttgtggagcctgcaaattcttgaggagaaaatgtgttagaggttgtatttttgcaccttacttttgccatgaacaaggtgc |
38752666 |
T |
 |
| Q |
101 |
tacccattttgcagctattcataaggtctttggtgcaagtaatgtttcaaagcttcttgcacacctccctgtgaccgatcgttgtgaagctgcagtcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752665 |
tacccattttgcagctattcataaggtctttggtgcaagtaatgtttcaaagcttcttgcacacctccctgtgaccgatcgttgtgaagctgcagtcaca |
38752566 |
T |
 |
| Q |
201 |
atctcttatgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccaacaacaggtttgttcatctc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38752565 |
atctcttatgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccagcaacaggtttgttcatctc |
38752475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 8 - 282
Target Start/End: Original strand, 30903962 - 30904236
Alignment:
| Q |
8 |
ttctggttctccttgtggagcctgcaaattcttgaggagaaaatgtgttagaggttgtgtttttgcaccttacttttgccatgaacaaggtgctacccat |
107 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||| ||||||||| | ||||||||||||||||||||||| |||| ||||||||||||||||| ||| |
|
|
| T |
30903962 |
ttctggttctccttgtggagcttgcaaatttttgagaagaaaatgtataagaggttgtgtttttgcaccttatttttctcatgaacaaggtgctacacat |
30904061 |
T |
 |
| Q |
108 |
tttgcagctattcataaggtctttggtgcaagtaatgtttcaaagcttcttgcacacctccctgtgaccgatcgttgtgaagctgcagtcacaatctctt |
207 |
Q |
| |
|
||| |||| ||||||||||| ||||||||||| ||||| |||||||||||||| || |||||||| | ||||| || ||||| || || |||||||||| |
|
|
| T |
30904062 |
ttttcagccattcataaggtttttggtgcaagcaatgtctcaaagcttcttgctcatctccctgtaagtgatcgctgcgaagccgctgttacaatctctt |
30904161 |
T |
 |
| Q |
208 |
atgaagctcaagctagacttcaagatccaatttatggatgtgttgcccatatttttgcactccaacaacaggttt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||| || ||||||||||||| |
|
|
| T |
30904162 |
atgaagctcaagctagacttcaagatcctatttatggatgtgtttcacatatttttgccctacaacaacaggttt |
30904236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University