View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_high_20 (Length: 295)
Name: NF14285_high_20
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 49584341 - 49584057
Alignment:
| Q |
1 |
attgttggtaaccagcttccattgaaggcacaaaggaaagaggagaatggtaagtgggaattcacttgggatgaggattcacttcttttacagctgaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584341 |
attgttggtaaccagcttccattgaaggcacaaaggaaagaggagaatggtaagtgggaattcacttgggatgaggattcacttcttttacagctgaaag |
49584242 |
T |
|
| Q |
101 |
atggtcttggtgatgatgttgaaacaatctatattggttgtcttaaagaagaaattgatccaattgagcaagatgatgttgctcagttcttgcttgacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49584241 |
atggtcttggtgatgatgttgaaacaatctatattggttgtcttaaagaagaaattgatccaattgagcaagatgatgttgctcagtacttgcttgacaa |
49584142 |
T |
|
| Q |
201 |
tttcaaatgtgtaccaactttccttccacctgaacttttcactaaattctatcatggtttctgtaaacaacatctatggcctttg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584141 |
tttcaaatgtgtaccaactttccttccacctgaacttttcactaaattctatcatggtttctgtaaacaacatctatggcctttg |
49584057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 269
Target Start/End: Complemental strand, 11698415 - 11698339
Alignment:
| Q |
193 |
cttgacaatttcaaatgtgtaccaactttccttccacctgaacttttcactaaattctatcatggtttctgtaaaca |
269 |
Q |
| |
|
||||| |||||||||||||| || ||||| |||||||||||| | || || || | |||||||||||| || ||||| |
|
|
| T |
11698415 |
cttgagaatttcaaatgtgtccctacttttcttccacctgaaatgtttaccaagtactatcatggtttttgcaaaca |
11698339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University