View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_high_23 (Length: 260)
Name: NF14285_high_23
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 5 - 234
Target Start/End: Complemental strand, 2088374 - 2088142
Alignment:
| Q |
5 |
cctatcagtattttgatattttcaaatagtattttcatctcttatttatataatcttgtatttttaatggtgaagccacttttctgttgtgtgcacatgt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2088374 |
cctatcagtattttgatattttcaaatagtattttcatctcttatttatata-tcttgtatttttaatggtgaagccacttttctgttgtgtgcacatgt |
2088276 |
T |
 |
| Q |
105 |
aatgacgttgg--------attcaactagnnnnnnnnnnnnnntcatggttgaaatataaggttttcaacttaacatctttatatcttctctttgagagt |
196 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
2088275 |
aatgacgttggatttcaatattcaactag----atatatatattcatggttgaaatataaggttttcaacttcacatttttatatcttctctttgagagt |
2088180 |
T |
 |
| Q |
197 |
tatcgtgaagtattttataagcgtaatttttgtatact |
234 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2088179 |
tatcttgaagtattttataagcgtaatttttgtatact |
2088142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University