View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14285_high_26 (Length: 250)

Name: NF14285_high_26
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14285_high_26
NF14285_high_26
[»] chr2 (1 HSPs)
chr2 (1-228)||(1325252-1325479)


Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 1325479 - 1325252
Alignment:
1 taacagttaatgcagaagcattaaacttcttgaagaagnnnnnnngctttgtggacaatactagagaatgaaatataatagagtaagttaggaattagga 100  Q
    |||||||||||| |||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1325479 taacagttaatggagaagcattaaacttcttgaagaagaaaaaaagctttgtggacaatactagagaatgaaatataatagagtaagttaggaattagga 1325380  T
101 ccatgacaattgcatctcttgctgccaatgcaacaatatctgcacaagaaaccactcctggacaggatgcttctaattgtgccttggctctttctatcac 200  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1325379 ccatgacaattgcatctctagctgccaatgcaacaatatctgcacaagaaaccactcctggacaggatgcttctaattgtgccttggctctttctatcac 1325280  T
201 ttcaaatcctttaacacctgcatgtgga 228  Q
    ||||||||||||||||||||||||||||    
1325279 ttcaaatcctttaacacctgcatgtgga 1325252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University