View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_high_31 (Length: 231)
Name: NF14285_high_31
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 35353726 - 35353527
Alignment:
| Q |
14 |
caaaggtggcatgttgcggtcaaggaccttataatggaattggactgtgcacattggcatcaagcatatgtcaaaaccgtgacgaccatttattttggga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35353726 |
caaaggtggcatgttgcggtcaaggaccttataatggaattggactgtgcacattggcatcaagcatatgtcaaaaccgtgacgaccatttattttggga |
35353627 |
T |
|
| Q |
114 |
tgcatttcatccatctgaaagagccaacaaaatgatcgttaagcaaatcatgacaggttccacagatgttatatacccaatgaatctcagcaccattttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35353626 |
tgcatttcatccatctgaaagagccaacaaaatgatcgttaagcaaatcatgacaggttccacagatgttatatacccaatgaatctcagcaccattttg |
35353527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 133
Target Start/End: Complemental strand, 35357759 - 35357731
Alignment:
| Q |
105 |
attttgggatgcatttcatccatctgaaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35357759 |
attttgggatgcatttcatccatctgaaa |
35357731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University