View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_high_4 (Length: 585)
Name: NF14285_high_4
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_high_4 |
 |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |  |
|
| [»] scaffold0127 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0140 (2 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0267 (1 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0891 (1 HSPs) |
 |  |  |
|
| [»] scaffold1674 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0468 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold1899 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0256 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 352; Significance: 0; HSPs: 78)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 103 - 575
Target Start/End: Original strand, 47569400 - 47569882
Alignment:
| Q |
103 |
ttatcactctgttattggttgactatacgaagagggagcaagaagtgttgttatgaataacattgcacaaagggtggaaaagttgctacgtgctaaacan |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47569400 |
ttatcactctgttattggtagactatacgaagagggagcaagaagtgttgttatgaataacattgcacaaagggtggaaaagttgctacgtgctaaacat |
47569499 |
T |
 |
| Q |
203 |
nnnnnnaatcttgaa-taaataaatatgattgaacaacaacaaactatttaaagtgggcttgtttggtgaagcattggcgttatccaaagacaatggttg |
301 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47569500 |
ttttttaatcttgaaataaataaatatgattgaacaacaacaaactatttaaagtgggcttgtttggtgaagcattgacgttatccaaagacaatggttg |
47569599 |
T |
 |
| Q |
302 |
gtttggtttgcttgcattgtgttcctgatgatgatatggtattttcactttcgtagcaataaggaggctcacactctttgtgtgtaagatatatgaaaat |
401 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47569600 |
gtttggtttgcttgcgttgtgttcctgatgatgatatggtattttcactttcgtagcaataaggaggctcacactctttgtgtgtaagatatatgaaaat |
47569699 |
T |
 |
| Q |
402 |
aagctagggtggtgcaaaagaaccatgcttttgtggaatgtagattacatgctttctagttttctaatttaaggactacgnnnnnnnnnnnnnnnnnnaa |
501 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
47569700 |
aagctagggtggtgcaaaagaaccatgcttttgtggaatgtagattacatgctttctagttttctaatttaaggactatgtttttgcttttattttttaa |
47569799 |
T |
 |
| Q |
502 |
tatttataatgtctggatttgtgcaatatataaatacgc---------attttatgctctttgattatataaatacgcctatg |
575 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47569800 |
tatttataatgtctggatttgtgcaatatataaatacgcatgtttcttattttatgctctttgattatataaatacgcctatg |
47569882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 221 - 477
Target Start/End: Complemental strand, 24621459 - 24621195
Alignment:
| Q |
221 |
ataaatatgattgaacaacaacaaactatttaaagtgggc-----ttgtttggtgaagcattggcgttatccaaagacaatggttggtttggtttgct-- |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||| ||||||||||||||||||||||| | |
|
|
| T |
24621459 |
ataaatatgattgaacaacaacaaactatttaaagtggacagtctttgtttggtgaagcattgatgttatcctaagacaatggttggtttggtttggtct |
24621360 |
T |
 |
| Q |
314 |
---tgcattgtgttcctgatgatgatatggtattttcactttcgtagcaataaggaggctcacactctttgtgtgtaagatatatgaaaataagctaggg |
410 |
Q |
| |
|
| | ||| ||||| |||||||||||||||| | || | | | ||| |||||| ||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
24621359 |
ggtttcgttgcattcctaatgatgatatggtattgtaacctgcagaacaacaaggag--tcacactctccttgtgtaagatatatggaaataagctagaa |
24621262 |
T |
 |
| Q |
411 |
tggtgcaaaagaaccatgcttttgtggaatgtagattacatgctttctagttttctaatttaaggac |
477 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||| | ||| ||||||||||||| |||||| |
|
|
| T |
24621261 |
tggtgcaaaacaaccatgcttttgttgaatgtagattactttttttttagttttctaattaaaggac |
24621195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 16226525 - 16226610
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
16226525 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaatt |
16226610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 23 - 104
Target Start/End: Original strand, 47177722 - 47177804
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
47177722 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttgatcgaattcacaacaatt |
47177804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 2617874 - 2617958
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
2617874 |
acactttgattttggttgcttgattatcccttgcttcacacatcaagttgttattggtgtggttttcatcgaattcgcaacaatt |
2617958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 9459358 - 9459277
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
9459358 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
9459277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 9463185 - 9463104
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
9463185 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
9463104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 16231920 - 16232002
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
16231920 |
acactttgattttggttgcttgattatccgttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
16232002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 51750396 - 51750477
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
51750396 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttatcgaattcgcaacaa |
51750477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 51757892 - 51757976
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgt-gtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
51757892 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtcatttttcatcgaattcacaacaatt |
51757976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 23 - 101
Target Start/End: Original strand, 47180073 - 47180152
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
47180073 |
ctttgattttgattgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttgatcgaattcacaaca |
47180152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 13358930 - 13359012
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
13358930 |
acactttgattttggttgcttgactatcccttactccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaa |
13359012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 13447197 - 13447117
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
13447197 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
13447117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 23786205 - 23786278
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
23786205 |
ttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
23786278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 10399752 - 10399692
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10399752 |
acactttgattttggttgcttgattatctcttgctccacacatcaagttgttattggtgtg |
10399692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 20291813 - 20291897
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||| ||| |||||||| |||||||||| |||||||||||||||||||||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
20291813 |
acaccttgattttggttacttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaatt |
20291897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 24326029 - 24326101
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
24326029 |
tttggttgcttgattatcccttactccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
24326101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 39932432 - 39932514
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
39932432 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaaca |
39932514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 2949153 - 2949079
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
2949153 |
ttttggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaaca |
2949079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 90
Target Start/End: Complemental strand, 15294758 - 15294689
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcg |
90 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
15294758 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcg |
15294689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 23816242 - 23816323
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
23816242 |
acactttgtttt-ggttgcttgattattccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaaca |
23816323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 28206995 - 28206909
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||| |||||||| |||||||||||||||||| |||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
28206995 |
acactttgattttggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgttttctcatcgaattcacaacaatt |
28206909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 28842851 - 28842932
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||| |||| |||| |||| |||||| |
|
|
| T |
28842851 |
acactttgtttt-ggttgcttgattatcccttactccacacatcaagttgttattagtgtgattttcatcgaattcgcaacaa |
28842932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 51752726 - 51752806
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||| |||| |||| ||||||||||| |
|
|
| T |
51752726 |
acactttgtttt-ggttgcttgattatcccttgctccacacat-aagttattattggtgtgattttcatcgaattcacaacaa |
51752806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 3579504 - 3579431
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
3579504 |
ttttggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgtttttcatcgaattcacaaca |
3579431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 13762193 - 13762257
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
13762193 |
acactttgtttt-ggttgcttgattatccctttctccacacatcaagttgttattggtgtgatttt |
13762257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 47906632 - 47906704
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
47906632 |
tttggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaaca |
47906704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 31735446 - 31735388
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgt |
79 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31735446 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgt |
31735388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 46431621 - 46431546
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||||| |||| |||| ||||||| |
|
|
| T |
46431621 |
ttttggttgcttgattatctcttgctccaaacatcaagttgttattggtgtgatttttcatcgaattcgcaacaat |
46431546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 14097898 - 14097832
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
14097898 |
acactttgattttggttgcttgattatctcttgcttcacacatcaagtttgttattggtgtgttttt |
14097832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 16429305 - 16429390
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||||||||||||||||| |||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
16429305 |
acactttgtttt-ggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaacaatt |
16429390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 25251203 - 25251118
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| ||||| |||| |||||||| |||| |
|
|
| T |
25251203 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaataatt |
25251118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 20302798 - 20302879
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||| ||| |||||||| |||||||||| ||||||||| |||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
20302798 |
acaccttgattttggttacttgattatctcttgctccagacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
20302879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 39462873 - 39462956
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
39462873 |
acactttgattttgattgcctgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
39462956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 12302434 - 12302368
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| |||||||| | |||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12302434 |
acactttgattttggtttcctgattatcacttgctccacacatcaagtttgttattggtgtgttttt |
12302368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 27336867 - 27336801
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
27336867 |
acactttgattttggttgcctgattatcccttgctccacacatcaagtttgttattgatgtgatttt |
27336801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 31490272 - 31490346
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||| |||| |||| |||||| |
|
|
| T |
31490272 |
ttttggttgcttgattatctcttgctccacacatcaagtttgtattggtgtgatttttcatcgaattcgcaacaa |
31490346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 50078718 - 50078653
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
50078718 |
acactttgtttt-ggttgcttgattattccttgctccacacatcaagtttgttattggtgtgatttt |
50078653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 14183536 - 14183452
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| |||||||||||| | ||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
14183536 |
acactttgtttt-ggttgcttgattattacttgcttcacacatcaagtattttattggtgtgatttttatcgaattcacaacaatt |
14183452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 28841036 - 28841088
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttat |
73 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28841036 |
acactttgtttt-ggttgcttgattatcccttgctccactcatcaagttgttat |
28841088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 41647272 - 41647357
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||| ||||||||| |||||||| |||||||| ||||||||| |||||||||||||||||| | |||| |||||||||||| |
|
|
| T |
41647272 |
acactttgattttggttgtctgattatcacttgctccgcacatcaagtttgttattggtgtgttttctcatcgaattcacaacaat |
41647357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 50307472 - 50307387
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||| |||||||| || ||||||||||| ||||| |||| |||| ||||||| |
|
|
| T |
50307472 |
acactttgattttggttgcctgattatcccttgctccagacatcaagtttattattggtgtgatttttcatcgaattcccaacaat |
50307387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 6995622 - 6995539
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
6995622 |
acactttgtttt-gattgcttgactatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaacaa |
6995539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 98
Target Start/End: Complemental strand, 9241016 - 9240937
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcaca |
98 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||| ||||| |||||||||||||| ||||| |||| ||||||| |
|
|
| T |
9241016 |
acactttgtttt-ggttgcttgattatcacttgctccacacttcaagtttgttattggtgtgattttttatcgaattcaca |
9240937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 104
Target Start/End: Complemental strand, 8348977 - 8348902
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||||||| ||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
8348977 |
tttggttgcttgattattacttgttccacacgtcaagtttttattggtgtgatttttcatcgaattcacaacaatt |
8348902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 431 - 478
Target Start/End: Original strand, 28239756 - 28239803
Alignment:
| Q |
431 |
tttgtggaatgtagattacatgctttctagttttctaatttaaggact |
478 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28239756 |
tttgtgcaatgtagattacatgctttctagtttgctaatttaaggact |
28239803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 50248499 - 50248417
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||| || |||||||||||||| ||| | |||| |||||||||| |
|
|
| T |
50248499 |
acactttgtttt-ggttgcttgattatcccttactccacacatcaaatttgttattggtgtgatttatcatcgaattcacaaca |
50248417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 15823901 - 15823967
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| |||||||||| |||||| ||||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
15823901 |
acactttgattttggttgcctgattaccccttactccacacatcaagtttgttattggtgtgatttt |
15823967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 27339058 - 27338992
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| ||||||||||||| ||||||||| |||| |||| |
|
|
| T |
27339058 |
acactttgattttggttgcctgattatcccttgttccacacatcaagtttgttattgatgtgatttt |
27338992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 2510266 - 2510202
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||| |||| |||||||||||||||||||| |||| |
|
|
| T |
2510266 |
acactttgttttcg-ttgcttgattatctcttgcttcacatatcaagttgttattggtgtgatttt |
2510202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 4131304 - 4131244
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
4131304 |
acactttgtttt-ggttgcttgattatctcttgctccgcacatcaagtttgttattggtgtg |
4131244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 13215436 - 13215500
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
13215436 |
acactttgtttt-ggttgtttgactatcccttgctccacacatcaagtttattattggtgtgtttt |
13215500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 30 - 104
Target Start/End: Complemental strand, 28998167 - 28998091
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |||| ||||||||||||| | ||| ||||||||||||| |
|
|
| T |
28998167 |
tttggttgcctgattatcacttgctccacacatcaagtttgtcattggtgtgttttctcttcgaattcacaacaatt |
28998091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 30 - 104
Target Start/End: Complemental strand, 29003883 - 29003807
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |||| ||||||||||||| | ||| ||||||||||||| |
|
|
| T |
29003883 |
tttggttgcctgattatcacttgctccacacatcaagtttgtcattggtgtgttttctcttcgaattcacaacaatt |
29003807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 32 - 78
Target Start/End: Original strand, 17324437 - 17324484
Alignment:
| Q |
32 |
tggttgcttgattatcccttgctccacacatcaag-ttgttattggtg |
78 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
17324437 |
tggttgcttgattattccttgctccacacatcaagtttgttattggtg |
17324484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 21 - 68
Target Start/End: Original strand, 25128225 - 25128272
Alignment:
| Q |
21 |
cactttgtttttggttgcttgattatcccttgctccacacatcaagtt |
68 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
25128225 |
cactttgattttggttgcttgattattccttgctctacacatcaagtt |
25128272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 25248480 - 25248398
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||| ||| |||| |||||||||||||| ||||||||| |||| ||||| |||| |||||||||| |
|
|
| T |
25248480 |
acactttgtttt-ggttgcttgactattccttactccacacatcaagtttgttattgttgtgatttttcatcgaattcacaaca |
25248398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 226 - 272
Target Start/End: Original strand, 28231897 - 28231944
Alignment:
| Q |
226 |
tatgattgaacaacaa-caaactatttaaagtgggcttgtttggtgaa |
272 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
28231897 |
tatgattgaacaacaaacaaactatttaaagtgggcgtgtttggtgaa |
28231944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 15916740 - 15916821
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||| | ||||||||||||||||||| ||||||||||| |||| |||| |||||||||| |
|
|
| T |
15916740 |
acactttgtttt-ggttgcttgattgttacttgctccacacatcaagtatttattggtgtgacttttcatcgaattcacaaca |
15916821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 102
Target Start/End: Original strand, 18839957 - 18840023
Alignment:
| Q |
38 |
cttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
18839957 |
cttgattattccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaacaa |
18840023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 30790331 - 30790250
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| ||||||||| || | ||||||||||| |||| |||| |||||||||| |
|
|
| T |
30790331 |
acactttgtttt-ggttgcttgattattacttgcttcacacatcaggtattttattggtgtgattttcatcgaattcacaaca |
30790250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 32 - 85
Target Start/End: Complemental strand, 31424933 - 31424879
Alignment:
| Q |
32 |
tggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
31424933 |
tggttgcttgagtattccttgctccacacatcaagtttgttattggtgtgatttt |
31424879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 38925412 - 38925346
Alignment:
| Q |
20 |
acactttg-tttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||| |||||||||||||| || ||||||||||||||| |
|
|
| T |
38925412 |
acactttgatttttggttgcctgattatcacttactccacacatcaagtttattattggtgtgtttt |
38925346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 11457396 - 11457339
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||| |||||||| |||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
11457396 |
ttttggttgcctgattatcacttgcttcacacatcaagtttgttattggtgtgatttt |
11457339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 440 - 477
Target Start/End: Original strand, 12541139 - 12541176
Alignment:
| Q |
440 |
tgtagattacatgctttctagttttctaatttaaggac |
477 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12541139 |
tgtagattacatgctttctagttttttaatttaaggac |
12541176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 17186061 - 17185977
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| |||||||||| |||| ||||||||||| |||||| || ||||||||||| ||||| ||| |||||||||||| |
|
|
| T |
17186061 |
acactttgtttt-ggttgcttgactatcacttgctccacatatcaagtttattattggtgtgatttttcatcaaattcacaacaat |
17185977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 47451983 - 47452066
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| ||||||| || ||||||||| |||| ||||| || | ||||||||||| |
|
|
| T |
47451983 |
acactttgtttt-ggttgcttgactatcccttgctcgacacatcaaatttgttattgatgtgatttttcattgaattcacaacaa |
47452066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 17319239 - 17319321
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||| ||||||||||| || |||||||||||| | ||||| |||| |||||||||| |
|
|
| T |
17319239 |
acactttgtttt-ggttgtttgattattccttactccacacatcaaatttgttattggtgcgatttttcatcgaattcacaaca |
17319321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 226 - 269
Target Start/End: Original strand, 28239593 - 28239636
Alignment:
| Q |
226 |
tatgattgaacaacaacaaactatttaaagtgggcttgtttggt |
269 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||| ||||||||| |
|
|
| T |
28239593 |
tatgattgaactacaacaaactatttatagtgggattgtttggt |
28239636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 251 - 301
Target Start/End: Complemental strand, 2288644 - 2288594
Alignment:
| Q |
251 |
taaagtgggcttgtttggtgaagcattggcgttatccaaagacaatggttg |
301 |
Q |
| |
|
||||||||||||||||| |||||||| | ||||| | |||||||||||||| |
|
|
| T |
2288644 |
taaagtgggcttgtttgctgaagcatggacgttaccaaaagacaatggttg |
2288594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 29 - 67
Target Start/End: Complemental strand, 6115027 - 6114989
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagt |
67 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
6115027 |
ttttggttgcttgattatcactttctccacacatcaagt |
6114989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 30780398 - 30780482
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctc--cacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||| ||||||||||| |||||||||||||| |||| |||| |||||||||| |
|
|
| T |
30780398 |
acactttgtttt-ggttgcttgattattccttactccacacacatcaagtttgttattggtgtgagttttcatcgaattcacaaca |
30780482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 31422780 - 31422706
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||||| ||||||||| |||| ||||| |||| |||| ||||| |
|
|
| T |
31422780 |
ttttagttgattgattattccttgctccacacatcaagtttgttattgatgtgatttttcatcgaattcgcaaca |
31422706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 40134294 - 40134378
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattat--cccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||| ||||||| | |||||||||||||||||| ||||||||| |||| ||||| |||| |||||||||| |
|
|
| T |
40134294 |
acactttgtttt-ggttgcctgattatatcacttgctccacacatcaagtttgttattgatgtgatttttcatcgaattcacaaca |
40134378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 50 - 106
Target Start/End: Complemental strand, 3091012 - 3090955
Alignment:
| Q |
50 |
ttgctccacacatcaagttgttattggtgtgtttttg-atcggattcacaacaattat |
106 |
Q |
| |
|
||||||||||||| || || ||||||||||||||||| | || ||||||||||||||| |
|
|
| T |
3091012 |
ttgctccacacatgaaatttttattggtgtgtttttgcaacgaattcacaacaattat |
3090955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 36 - 80
Target Start/End: Complemental strand, 17324546 - 17324501
Alignment:
| Q |
36 |
tgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
17324546 |
tgcttgactatcccttactccacacatcaagtttgttattggtgtg |
17324501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 542 - 575
Target Start/End: Original strand, 28232288 - 28232321
Alignment:
| Q |
542 |
ttttatgctctttgattatataaatacgcctatg |
575 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
28232288 |
ttttatgctctttgattatataaatatgcctatg |
28232321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 542 - 575
Target Start/End: Original strand, 28239928 - 28239961
Alignment:
| Q |
542 |
ttttatgctctttgattatataaatacgcctatg |
575 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
28239928 |
ttttatgctctttgattatataaatatgcctatg |
28239961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 105; Significance: 4e-52; HSPs: 41)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 4e-52
Query Start/End: Original strand, 103 - 476
Target Start/End: Original strand, 16375461 - 16375829
Alignment:
| Q |
103 |
ttatcactctgttattggttgactatacgaagagggagcaagaagtgttgttatgaataacattgcacaaagggtggaaaagttgctacgtgctaaacan |
202 |
Q |
| |
|
|||||||||| |||| | | |||||||| ||| |||| |||||||||||||||||| ||| ||| |||||| |||||| ||||||||| || | |||| |
|
|
| T |
16375461 |
ttatcactctattatcgatagactatacaaagggggatcaagaagtgttgttatgattaagattacacaaaaggtggatgagttgctacttgttgaacat |
16375560 |
T |
 |
| Q |
203 |
nnnnnnaatcttga-ataaataaatatgattgaacaacaacaaactatttaaagtgggcttgtttggtgaagcattggcgttatccaaagacaatg-gtt |
300 |
Q |
| |
|
|||||| || ||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||| |||| | ||||||||| ||| |
|
|
| T |
16375561 |
tat---aatcttattatgaataaatatgattgaacaataaaaaactatttaaagtgagcttgtttggtgaagcattggtgttagc-aaagacaatttgtt |
16375656 |
T |
 |
| Q |
301 |
ggtttggtttgcttgcattgtgttcctgatgatgatatggtattttcactttcgtagcaataagga--ggctcacactctttgtgtgtaagatatatgaa |
398 |
Q |
| |
|
||||||||||| |||| || ||| |||||||||| |||| | |||||| | |||| |||| || ||| |||| ||||||||||||||||| | |
|
|
| T |
16375657 |
ggtttggtttggttgcctt-----cctaatgatgatattatattgtaactttcagatcaatgaggacaggtacactctctatgtgtgtaagatatatgga |
16375751 |
T |
 |
| Q |
399 |
aataagctagggtggtgcaaaagaaccatgcttttgtggaatgtagattacatgctttctagttttctaatttaagga |
476 |
Q |
| |
|
|||| | |||| |||| |||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
16375752 |
aatacgttaggatggtacaaaagaaccatgcttttgtggtatgtagattacatgctttgtagttttctaattaaagga |
16375829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 19504259 - 19504175
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
19504259 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaatt |
19504175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 19501924 - 19501842
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
19501924 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaa |
19501842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 20 - 95
Target Start/End: Complemental strand, 23452159 - 23452084
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattc |
95 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| |
|
|
| T |
23452159 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattc |
23452084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 29 - 108
Target Start/End: Original strand, 42453818 - 42453897
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaattatca |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| |||||||||||| |||| |
|
|
| T |
42453818 |
ttttggttgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaatgatca |
42453897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 35215506 - 35215433
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
35215506 |
ttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttgatcagattcacaaca |
35215433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 35217883 - 35217807
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35217883 |
ttttggttgcttaattatctcttgctccacacatcaagttgttattggtgtgatttttgatcagattcacaacaatt |
35217807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 36561054 - 36560978
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
36561054 |
ttttggttgcttgattattccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaatt |
36560978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 36558794 - 36558721
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||| |||||||||| |
|
|
| T |
36558794 |
ttttggttgcttgattatcccttgctccacacatcaagttattattggtgtgatttttcatcgaattcacaaca |
36558721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 42923434 - 42923369
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42923434 |
acactttgtttttggttgcttgattatctcttgctccacacatcaagtttgttattggtgtgtttt |
42923369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 45332093 - 45332019
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
45332093 |
ttttggttgcttaattatcccttgttccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaa |
45332019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 13909967 - 13909908
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13909967 |
acactttgtttt-ggttgcttgattatcccttactccacacatcaagttgttattggtgtg |
13909908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 45279923 - 45279864
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45279923 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtg |
45279864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 22287255 - 22287180
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
22287255 |
ttttggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgttttctcatcgaattcacaacaa |
22287180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 27105130 - 27105195
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
27105130 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttt |
27105195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 28459119 - 28459038
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||| | ||||||||||| |||| |||| |||||||||| |
|
|
| T |
28459119 |
acactttgtttt-ggttgcttgattatcacttgctccacacatcaagtgttttattggtgtgattttcatcgaattcacaaca |
28459038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 17849445 - 17849528
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg--tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
17849445 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgattttttcatcgaattcacaaca |
17849528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 19007968 - 19008051
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg--tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
19007968 |
acactttgtttt-ggttgcttgattattccttgctccacacatcaagtttgttattggtgtgattttttcatcgaattcacaaca |
19008051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 24162138 - 24162086
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
24162138 |
tttttggttgcttgattatctctttctccacacatcaagttgttattggtgtg |
24162086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 21520617 - 21520531
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||| |||||||||| |||||||| |||||||||||||||||| |||||||||||||||||| | |||| |||| |||||||| |
|
|
| T |
21520617 |
acactttaattttggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgttttctcatcgaattcgcaacaatt |
21520531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 22162943 - 22162887
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
22162943 |
ttttggttgcttgattatcccttgcttcacacatcaaaattgttattggtgtgtttt |
22162887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 11739503 - 11739417
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatta |
105 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||| |||||||||| |||||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
11739503 |
acactttgtttttattt-cttgactatcccttgctctacacatcaagtttgttattggtgtgatttttcatcgaattcacaacaatta |
11739417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 74
Target Start/End: Original strand, 42064831 - 42064884
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttatt |
74 |
Q |
| |
|
|||||||||||| | ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42064831 |
acactttgttttag-ttgcttgatcatcccttgctccacacatcaagttgttatt |
42064884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 3022500 - 3022560
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
3022500 |
acactttgtttt-ggttgcttgattatcacttgctccacacatcaagtttgttatttgtgtg |
3022560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 6258744 - 6258680
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
6258744 |
acactttgtttt-ggttgcctgattatcacttgctccacacatcaagtttgttattggtatgtttt |
6258680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 14837596 - 14837679
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag--ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||| ||| | |||| |||||||||| |
|
|
| T |
14837596 |
acactttgtttt-ggttgcttgattatcacttgctccacacatcaagtattgttattgatgtgatttctcatcgaattcacaaca |
14837679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 70
Target Start/End: Original strand, 17848775 - 17848816
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgt |
70 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17848775 |
ttttggttgcttgattatcacttgctccacacatcaagttgt |
17848816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 7462872 - 7462825
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagtt |
68 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7462872 |
acactttgtttt-ggttgcttgattatcctttgctccacacatcaagtt |
7462825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 28196963 - 28197046
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||||||||||||| || |||||||||||||| ||||| |||| | ||||||||| |
|
|
| T |
28196963 |
acactttgtttt-ggttgctggactatcccttgctccacacatcaaatttgttattggtgtgatttttcatcgaactcacaacaa |
28197046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 34979508 - 34979452
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
34979508 |
ttttggttgctttattattccttactccacacatcaagtttgttattggtgtgtttt |
34979452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 22874437 - 22874519
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| | |||||||| |||| |||||||||||||||||| || ||||||||||| ||||| |||| |||||||||| |
|
|
| T |
22874437 |
acactttgttttag-ttgcttgactatcacttgctccacacatcaagtttattattggtgtgatttttcatcgaattcacaaca |
22874519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 43623506 - 43623423
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagtt-gttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||| |||||||||| |||||||| ||||||||||||||||||| |||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
43623506 |
acactttaattttggttgcctgattatctattgctccacacatcaagttagttattggtgtgatttttcatcgaattcgcaaca |
43623423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 6264075 - 6263990
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||| |||| || |||||||||||||||||| |||||||| ||||||||| | |||| ||||||||||||| |
|
|
| T |
6264075 |
acactttgtttt-ggttgcctgatagtcacttgctccacacatcaagtttgttattagtgtgttttctcatcgaattcacaacaatt |
6263990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 38020408 - 38020473
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||| ||||| || |||||||||||||| |||| |
|
|
| T |
38020408 |
acactttgtttt-ggttgcttgattattccttgctccatacatcaaatttgttattggtgtgatttt |
38020473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 5375272 - 5375225
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagtt |
68 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| |||||||||||||||| |
|
|
| T |
5375272 |
acactttgtttt-gattgcttgattatcccttactccacacatcaagtt |
5375225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 11578031 - 11577957
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| ||||| |||| ||||| |||| |||||||||| |
|
|
| T |
11578031 |
ttttggttgcttgattattacttgttccacacatcaagtttttattaatgtgattttttcatcgaattcacaaca |
11577957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 45238916 - 45238841
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||| || ||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
45238916 |
ttttggttgcttgactatcgcttggtccacacatcaagtttattattggtgtgatttttcatcgaattcgcaacaa |
45238841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 22707678 - 22707613
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||| | |||| ||||||||||| || |||||||||||||| |||| |
|
|
| T |
22707678 |
acactttgtttt-ggttgcttgattgttccttactccacacatcaaatttgttattggtgtggtttt |
22707613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 15539456 - 15539397
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| | ||||||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
15539456 |
acactttgtttt-gattgcttgataatcc-ttgctccacacatcaagtttgttattggtgtg |
15539397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 20592401 - 20592484
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtg--tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||| |||||||| || | ||||||||||| ||||| |||| |||||||||| |
|
|
| T |
20592401 |
acactttgtttt-ggttgcttgattattacttgctctacacatcacgtattttattggtgtgattttttcatcgaattcacaaca |
20592484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 49 - 84
Target Start/End: Complemental strand, 42923347 - 42923311
Alignment:
| Q |
49 |
cttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42923347 |
cttgctccacacatcaagtttgttattggtgtgtttt |
42923311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 3e-31; HSPs: 80)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 22132311 - 22132226
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
22132311 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattattgatcagattcacaacaatt |
22132226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 11006175 - 11006089
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt-gatcggattcacaacaattat |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
11006175 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttcgatcgaattcacaacaattat |
11006089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 11008489 - 11008405
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt-gatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11008489 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttcgatcgaattcacaacaatt |
11008405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 30 - 102
Target Start/End: Original strand, 18847572 - 18847645
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
18847572 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttgatcagattcacaacaa |
18847645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 2484787 - 2484715
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
2484787 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaaca |
2484715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 22046608 - 22046523
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
22046608 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcgatcgaattcacaacaatt |
22046523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 24348612 - 24348693
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
24348612 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaa |
24348693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 11435365 - 11435430
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11435365 |
acactttgtttttggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttt |
11435430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 22134538 - 22134454
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
22134538 |
acactttgtttt-ggttgtttgattatcccttgctccacacatcaagttgttattggtgtgattattgatcagattcacaacaatt |
22134454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 51015656 - 51015720
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51015656 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
51015720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 9176395 - 9176312
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||| |||||||| |
|
|
| T |
9176395 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcgtcgaattcgcaacaatt |
9176312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 23 - 102
Target Start/End: Complemental strand, 22780291 - 22780211
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
22780291 |
ctttgtttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaa |
22780211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 8631340 - 8631258
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||||||| |
|
|
| T |
8631340 |
acactttgttttag-ttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaat |
8631258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 11437773 - 11437856
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
11437773 |
acactttgtttttggctgcttgattatctcttgctccatacatcaagttgttattggtgtgatttttcatcgaattcacaacaa |
11437856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 47868812 - 47868895
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
47868812 |
acactttgattttggttgcctgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaa |
47868895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 9174067 - 9173986
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| |||| |||||| |
|
|
| T |
9174067 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattagtgtgattttcatcgaattcgcaacaa |
9173986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 23 - 85
Target Start/End: Complemental strand, 22782656 - 22782594
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22782656 |
ctttgtttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttt |
22782594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 22802659 - 22802574
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
22802659 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaacaatt |
22802574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 5198815 - 5198895
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||| |||| |||| |||||||||| |
|
|
| T |
5198815 |
acactttgtttt-ggttgcttgattatccattgctccacacatcaagttattattggtgtgattttcatcgaattcacaaca |
5198895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 5635398 - 5635318
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
5635398 |
acactttgtttt-ggttgattgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
5635318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 26085899 - 26085818
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| || | |||| |||| ||||| |
|
|
| T |
26085899 |
acactttgattttggttgcttgactatcccttgctccacacatcaagttgttattggtgtgattctcatcgaattcgcaaca |
26085818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 31849520 - 31849440
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
31849520 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
31849440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 38409623 - 38409696
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt-gatcggattcacaaca |
101 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
38409623 |
ttttagttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttcgattgaattcacaaca |
38409696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 384 - 470
Target Start/End: Original strand, 8331980 - 8332067
Alignment:
| Q |
384 |
tgtaagatatatgaaaataagctagggtggtgcaaaagaacca-tgcttttgtggaatgtagattacatgctttctagttttctaatt |
470 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| | |||| |||||||||||||||||| |||||||| ||||||| |
|
|
| T |
8331980 |
tgtaagatatatgaaaataagctaggatggtgcaaaagaaccattttttttttggaatgtagattacatgtattctagttgtctaatt |
8332067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 16931704 - 16931629
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
16931704 |
ttttggttgcttaattatcccttgctccacacattaagttgttattggtgtgatttttcatcgaattcacaacaat |
16931629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 22044313 - 22044255
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgt |
79 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22044313 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgt |
22044255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 14789355 - 14789270
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
14789355 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaacaatt |
14789270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 3937198 - 3937125
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
3937198 |
tttggttgcttgattatcccttgctcctcacatcaagttgttattggtgtgatttttcatcgaattcgcaacaa |
3937125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 7941734 - 7941814
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||| |||| |||| |||| ||||| |
|
|
| T |
7941734 |
acactttgtttt-ggttgcttaattatcccttgctccacacatcaagttgttgttggtgtgattttcatcgaattcgcaaca |
7941814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 18709085 - 18709021
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18709085 |
acactttgtttt-ggttgcttgattatgccttgctccacacatcaagttgttattggtgtggtttt |
18709021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 40637482 - 40637543
Alignment:
| Q |
20 |
acactttgtttt-tggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40637482 |
acactttgttttttggttgcttgattattccttgctccacacatcaagttgttattggtgtg |
40637543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 9148646 - 9148709
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9148646 |
acactttgtttt-ggttgcttgattatctcttgttccacacatcaagttgttattggtgtgtttt |
9148709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 6765253 - 6765335
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
6765253 |
acactttgtttt-ggttgcttgattatcccttactccacacatcaagtttgttattggtgtgatttttcatcgaattcacaaca |
6765335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 14787356 - 14787274
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
14787356 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
14787274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 17662163 - 17662108
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17662163 |
tttgattgcttgattatcccttgctccacacatcaagttgttattggtgtgatttt |
17662108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 38928106 - 38928024
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
38928106 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
38928024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 16453714 - 16453799
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||||||||||||||||| |||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
16453714 |
acactttgtttt-ggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaacaatt |
16453799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 36921412 - 36921335
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
36921412 |
ttttggttgcctgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaacaatt |
36921335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 53405552 - 53405629
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
53405552 |
ttttggttgcttgattatcccttgctccacacatcaagtttattattggtgtgatttttcatcgaattcgcaacaatt |
53405629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 5101322 - 5101405
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| ||||||||||||| |||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
5101322 |
acactttgtttt-ggttgcttgactatcccttgatccacacatcaagtttgttattggtgtgttttctcatcgaattcacaacaa |
5101405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 47210718 - 47210659
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47210718 |
acactttgtttt-ggttgctttattatctcttgctccacacatcaagttgttattggtgtg |
47210659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 33 - 80
Target Start/End: Original strand, 14633741 - 14633788
Alignment:
| Q |
33 |
ggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14633741 |
ggttgcttgattatctcttgctccacacatcaagttgttattggtgtg |
14633788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 16455632 - 16455714
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||||||||||||||||| |||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
16455632 |
acactttgtttt-ggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaaca |
16455714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 24446576 - 24446501
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| |||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
24446576 |
ttttggttgcttgattatcccttacttcacacatcaagtttgttattggtgtgttttctcatcgaattcacaacaa |
24446501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 33415417 - 33415334
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||| |||||||| ||||| ||| | ||||||||| ||||| |
|
|
| T |
33415417 |
acactttgattttggttgcttgactatcccttgctccacacatcaagtttgttatttgtgtgatttctcatcggattcgcaaca |
33415334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 37089294 - 37089212
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
37089294 |
acactttgtttt-ggttgcttgattatccattgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
37089212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 38270068 - 38269993
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| |||||||||||||||||| |||| |||| ||||||| |
|
|
| T |
38270068 |
ttttggttgcttgactatcccttactccacacatcaagtttgttattggtgtgttttctatcgaattcccaacaat |
38269993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 2891706 - 2891780
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||| |||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
2891706 |
ttttggttgcttgattattctttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaaca |
2891780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 3824528 - 3824466
Alignment:
| Q |
24 |
tttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
3824528 |
tttgattttggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgatttt |
3824466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 44599752 - 44599679
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
44599752 |
ttttggttgcttaattatcc-ttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaa |
44599679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 47563165 - 47563230
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
47563165 |
acactttgtttt-ggttgcttgattattccttgctccacacatcaagtttgttattggtgtggtttt |
47563230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 16934059 - 16933985
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| ||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
16934059 |
ttttggttgcttaatt--cccttgctccacacattaagttgttattggtgtgatttttcatcgaattcacaacaatt |
16933985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 36919503 - 36919446
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
36919503 |
ttttggttgcctgattatcccttgctccacacatcaagtttgttattggtgtgatttt |
36919446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 4215709 - 4215768
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
4215709 |
acactttgtttttg-ttgcttgattattccttgcttcacacatcaagttgttatttgtgtg |
4215768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 12395764 - 12395708
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12395764 |
ttttggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgtttt |
12395708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 12400726 - 12400670
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12400726 |
ttttggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgtttt |
12400670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 18409275 - 18409189
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg--tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||| |||| |||||||||||||||||| || ||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
18409275 |
acactttgtttt-ggttgcttgactatcacttgctccacacatcaagtttattattggtgtgattttttcatcgaattcacaacaatt |
18409189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 24889204 - 24889263
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24889204 |
acactttgtttt-ggttgttagattattccttgctccacacatcaagttgttattggtgtg |
24889263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 8756176 - 8756101
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| | |||||| |||| |||| |||| |||||||||||| |
|
|
| T |
8756176 |
ttttggttgcttgattattacttgctccacacatcaagtattttattgatgtgattttcatcgaattcacaacaat |
8756101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 22800779 - 22800705
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
22800779 |
ttttggttgcttgactatcccttgctccccacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
22800705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 37313006 - 37312941
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| || ||||||||||| |||| |
|
|
| T |
37313006 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttattattggtgtgatttt |
37312941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 41997893 - 41997958
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| |||||||||||||| || |||||||||||||||| |
|
|
| T |
41997893 |
acactttgtttt-ggttgcttgattatcactttctccacacatcaagtttattattggtgtgttttt |
41997958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 19323104 - 19323177
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| | ||||||||||| |||| |||| |||||||||| |
|
|
| T |
19323104 |
ttttagttgcttgattattacttgctccacacatcaagtattttattggtgtgattttcatcgaattcacaaca |
19323177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 40091334 - 40091258
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg--tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
40091334 |
ttttggttgcttgattatcttttgctccacacatcaagtttgttattggtgtgaatttttcatcgaattcgcaacaa |
40091258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 6133243 - 6133302
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgt |
79 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
6133243 |
acactttgtttc-ggttgcttgattattccttgctccacacatcaagtttgttattggtgt |
6133302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 47275138 - 47275194
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
47275138 |
ttttgattgcttgattatcccttactccacacatcaagtttgttattgatgtgtttt |
47275194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 49088962 - 49089045
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| ||| |||||||||| |||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
49088962 |
acactttgtttt-ggttgcttgactatcccttactcaacacatcaagtttgttattggtgtgatttttcatcgaattcgcaacaa |
49089045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 30 - 104
Target Start/End: Original strand, 36378705 - 36378780
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| | ||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
36378705 |
tttggttgcttgattattacttgctccacatatcaagtattttattggtgtgattttcatcgaattcgcaacaatt |
36378780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 5664641 - 5664722
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||| | | ||||||||||||||| | ||||||||||| |||| |||| |||||||||| |
|
|
| T |
5664641 |
acactttgtttt-ggttgcttgattattaccttctccacacatcaagtattttattggtgtgattttcatcgaattcacaaca |
5664722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 12102485 - 12102566
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttg-ttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||| | |||| ||||||||||||||||||| | ||||||||||| |||| |||| |||||||||| |
|
|
| T |
12102485 |
acactttgtttt-ggttgctcggttattacttgctccacacatcaagtagtttattggtgtgattttcatcgaattcacaaca |
12102566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 97
Target Start/End: Complemental strand, 18534764 - 18534687
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcac |
97 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| | ||||||||||| ||| |||| |||||| |
|
|
| T |
18534764 |
acactttgtttt-ggttgcttgattattacttgctccacacatcaagtattttattggtgtgagtttcatcgaattcac |
18534687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 27499462 - 27499536
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||| |||| | ||||||||||||||||| |||||||||||||| ||||| |||| ||||| |||| |
|
|
| T |
27499462 |
ttttggttgcttggttattcattgctccacacatcaagtttgttattggtgtgatttttcatcgaattcagaaca |
27499536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 13547560 - 13547625
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||| ||||||||| | |||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
13547560 |
acactttgattttggttgtctaattatcacttgttccacacatcaagtttgttattggtgtgtttt |
13547625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 619370 - 619316
Alignment:
| Q |
31 |
ttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| || || ||||||||||||||| |
|
|
| T |
619370 |
ttggttgcttgactatcccttactccacacatcaaatttattattggtgtgtttt |
619316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 18537406 - 18537321
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaacaatta |
105 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||||||||| | |||| |||||| || |||| |||||||||||||| |
|
|
| T |
18537406 |
acactttgtttt-gattgcttgattattacttgctccacacatcaagtattttataggtgtgaacttcatcgaattcacaacaatta |
18537321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 30 - 90
Target Start/End: Complemental strand, 15032466 - 15032405
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcg |
90 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||| | ||||||||||| |||| |||| |
|
|
| T |
15032466 |
tttggttgcttgattattacttgctccgcacatcaagtattttattggtgtgattttcatcg |
15032405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 50 - 86
Target Start/End: Original strand, 16639102 - 16639138
Alignment:
| Q |
50 |
ttgctccacacatcaagttgttattggtgtgtttttg |
86 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
16639102 |
ttgctccacacatcaagtttttattggtatgtttttg |
16639138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 44 - 104
Target Start/End: Complemental strand, 18311275 - 18311212
Alignment:
| Q |
44 |
tatcccttgctccacacatcaag-ttgttattggtgtg--tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
18311275 |
tatcacttgctccacacatcaagtttattattggtgtgattttttcatcgaattcacaacaatt |
18311212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 48486735 - 48486791
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgtttt |
84 |
Q |
| |
|
|||| |||||||||||||| |||| ||||| |||| || |||||||||||||||||| |
|
|
| T |
48486735 |
ttttagttgcttgattatcgcttgttccacgcatcaaatttgttattggtgtgtttt |
48486791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 28 - 102
Target Start/End: Complemental strand, 52043484 - 52043411
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||| | ||||||||||| |||| | | ||||||||||| |
|
|
| T |
52043484 |
tttttggttgcttgattattc--tgctccacacatcaagtattttattggtgtgatttttaacaaattcacaacaa |
52043411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 4e-30; HSPs: 41)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 4424431 - 4424514
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
4424431 |
acactttgtttttggttgcttgattatcccttgctccacacaccaagttgttattggtgtgattttcatcgaattcacaacaat |
4424514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 24873121 - 24873039
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
24873121 |
acactttgtttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
24873039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 32339722 - 32339804
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
32339722 |
acactttgattttggttgcttgattatcccttgccccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaa |
32339804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 43082386 - 43082467
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
43082386 |
acactttgtttt-ggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttgatcagattcacaaca |
43082467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 15809631 - 15809711
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
15809631 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
15809711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 18811120 - 18811205
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
18811120 |
acactttgattttggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaatt |
18811205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 43080015 - 43080099
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
43080015 |
acactttgtttt-ggttgcttaattatccattgctccacacatcaagttgttattggtgtgatttttgatcagattcacaacaatt |
43080099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 28283143 - 28283060
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| ||||||| |
|
|
| T |
28283143 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaat |
28283060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 44721256 - 44721337
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
44721256 |
acactttgtttt-ggttgcttgattatcccttactccacacatcaagttgttattggtgtgattattgatcagattcacaaca |
44721337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 22 - 85
Target Start/End: Complemental strand, 22684573 - 22684510
Alignment:
| Q |
22 |
actttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22684573 |
actttgattttggttgcctgattatcccttgctccacacatcaagttgttattggtgtgatttt |
22684510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 609148 - 609230
Alignment:
| Q |
20 |
acactttgtttt-tggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| ||||||||||||||||||| | |||| |||| |||||||||| |
|
|
| T |
609148 |
acactttgttttttggttgcttgattatctcttgctccacgcatcaagttgttattggtgcgattttcatcgaattcacaaca |
609230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 27827398 - 27827482
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
27827398 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgattttcatcgaattcgcaacaatt |
27827482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 43530528 - 43530592
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43530528 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttt |
43530592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 28251492 - 28251410
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
28251492 |
acactttgtttt-ggttgcctgattattccttgctccacacatcaagttgttattggtgtgattttttcatcgaattcacaaca |
28251410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 3874406 - 3874488
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||| ||||| | || ||||||||||| |
|
|
| T |
3874406 |
acactttgtttt-ggttgcttggttatctcttgctccacacatcaagttgttattggtgtgatttttcaacgaattcacaacaa |
3874488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 3883517 - 3883436
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||| ||||| |||| |||| ||||| |
|
|
| T |
3883517 |
acactttgtttt-ggttgcttgattatcctttgctccacacatcaagttgttattgatgtgatttttcatcgaattcgcaaca |
3883436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 18813294 - 18813376
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||| ||| |||||||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
18813294 |
acactttgattttggttgcttgattatctcttgctctacatatcaagttgttattggtgtgatttttcatcgaattcgcaaca |
18813376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 27829709 - 27829790
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
27829709 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgattttcatcgaattcgcaaca |
27829790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 33541329 - 33541255
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||| |||||||||| |
|
|
| T |
33541329 |
ttttgattgcttgattatcccttactccacacatcaagtttgttattggtgtgatttttgatcgaattcacaaca |
33541255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 2468060 - 2467976
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||| |||| |||||||||||||||||| || ||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
2468060 |
acactttgtttt-ggttgcttgactatcacttgctccacacatcaagtttattattggtgtgattttcatcgaattcacaacaatt |
2467976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 27106829 - 27106765
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27106829 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgtttt |
27106765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 25952936 - 25953011
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
25952936 |
ttttggttgcttgattatcactttctccacacatcaagtttgttattggtgtgttttctcatcgaattcacaacaa |
25953011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 35872375 - 35872300
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| |||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
35872375 |
ttttggttgcttgattatcccttacttcacacatcaagtttgttattggtgtgttttctcatcgaattcacaacaa |
35872300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 14808169 - 14808234
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
14808169 |
acactttgtttt-ggttgcttgattatccgttgctccacacatcaagtttgttattggtgtgatttt |
14808234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 15956361 - 15956445
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||||||| ||||||||| |||| ||||| |||| |||||||||||| |
|
|
| T |
15956361 |
acactttgtttt-ggttgtttgactatcccttgctccacacatcaagtttgttattgatgtgatttttcatcgaattcacaacaat |
15956445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 14477658 - 14477741
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||||||||| |||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
14477658 |
acactttgtttt-ggttgtctgattatcacttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaacaa |
14477741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 13858416 - 13858334
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||| || ||||||||||| ||||| |||| ||| |||||| |
|
|
| T |
13858416 |
acactttgtttt-ggttgcttgattatcacttgctccacacatcaagtttcttattggtgtgatttttcatcgaatttacaaca |
13858334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 15073120 - 15073202
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
15073120 |
acactttgtttt-gattgcttgactatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
15073202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 28 - 101
Target Start/End: Original strand, 21482723 - 21482798
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| || ||||||||||| ||||| |||| |||||||||| |
|
|
| T |
21482723 |
tttttggttgcttcattatcacttgctccacacatcaagtttattattggtgtgatttttcatcgaattcacaaca |
21482798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 14419117 - 14419032
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagtt-gttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||| | |||||||| ||||||||| |||||||||| |||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
14419117 |
acactttgtttt-ggtttcctgattatcacttgctccatacatcaagtttgttattggtgtgttttctcatcgaattcacaacaatt |
14419032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 15068390 - 15068475
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| ||||||||||||| ||||| |||||||| ||||| |||| |||| |||||||| |
|
|
| T |
15068390 |
acactttgtttt-ggttgcttgactatcccttgttccacacatcaagtttgttgttggtgtgatttttcatcgaattcgcaacaatt |
15068475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 36865947 - 36866012
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
36865947 |
acactttgtttt-ggttgcttgattatcacttgctccacacatcaagtttgttattgatgtggtttt |
36866012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 41383080 - 41383137
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
41383080 |
ttttgattgcttgattatctcttgctccacacatcaagtttgttattggtgtggtttt |
41383137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 39 - 101
Target Start/End: Original strand, 183246 - 183310
Alignment:
| Q |
39 |
ttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaaca |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||| | |||| |||||||||| |
|
|
| T |
183246 |
ttgactatcccttgctccacacatcaagtttgttattggtgtgttttctcatcgaattcacaaca |
183310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 30 - 101
Target Start/End: Complemental strand, 3005558 - 3005486
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| | ||||||||||| |||| |||| |||||||||| |
|
|
| T |
3005558 |
tttggttgtttgattattacttgctccacacatcaagtattttattggtgtgattttcatcgaattcacaaca |
3005486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 15185646 - 15185564
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| |||||||||||||| ||||||||| |||| ||||| | || |||||||||| |
|
|
| T |
15185646 |
acactttgtttt-ggttgcttgactatcccttactccacacatcaagtttgttattgatgtgatttttcaccgaattcacaaca |
15185564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 37214191 - 37214127
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| ||||||||| ||||| ||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
37214191 |
acactttgtttt-ggttgcttgcttatctcttactccatacatcaagtttgttattggtgtgtttt |
37214127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 29 - 76
Target Start/End: Original strand, 1225571 - 1225619
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagt-tgttattgg |
76 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
1225571 |
ttttggttgcttgattattccttgttccacacatcaagtatgttattgg |
1225619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 30480430 - 30480371
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgt |
79 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||||| || ||||||||||||| |
|
|
| T |
30480430 |
acactttgtttt-ggttgcttgattattccttactccacacatcaaatttgttattggtgt |
30480371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 21480906 - 21480993
Alignment:
| Q |
20 |
acactttgttttt-ggttgcttgattatcccttgctccacacatcaag-ttgttattggtg-tgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||| ||||| |||||| || ||| |||||||||||||| || ||||||||| | ||||| |||| ||||||||||||| |
|
|
| T |
21480906 |
acactttgttttttggttgtttgattgtcacttactccacacatcaagtttattattggtgttatttttcatcgaattcacaacaatt |
21480993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 5372100 - 5372043
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
5372100 |
ttttagttgcttgaatatccattgctccacacatcaagtttgttattgatgtgatttt |
5372043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 7e-29; HSPs: 63)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 23 - 104
Target Start/End: Original strand, 10750059 - 10750140
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
10750059 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgattttgatcgaattcacaacaatt |
10750140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 23 - 102
Target Start/End: Original strand, 10757535 - 10757614
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
10757535 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgattttgatcgaattcacaacaa |
10757614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 34476975 - 34476892
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||||||| |
|
|
| T |
34476975 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaat |
34476892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 34479340 - 34479256
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||| |||||||| |
|
|
| T |
34479340 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcaaattcgcaacaatt |
34479256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 2175258 - 2175341
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg---tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
2175258 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgacttttttgatcgaattcacaaca |
2175341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 31543099 - 31543175
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
31543099 |
ttttggttgcttgattaacccttgctccacacatcaagttgttattggtgtgattattgatcagattcacaacaatt |
31543175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 23 - 101
Target Start/End: Complemental strand, 3373056 - 3372977
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
3373056 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
3372977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 28 - 102
Target Start/End: Original strand, 4410385 - 4410459
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | || |||| |||||| |
|
|
| T |
4410385 |
tttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcaacgaattcgcaacaa |
4410459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 23 - 104
Target Start/End: Complemental strand, 15356769 - 15356687
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
15356769 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaacaatt |
15356687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 23 - 104
Target Start/End: Original strand, 23665405 - 23665487
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
23665405 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaacaatt |
23665487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 23 - 104
Target Start/End: Complemental strand, 23793182 - 23793100
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
23793182 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaacaatt |
23793100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 38960053 - 38959972
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
38960053 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaaca |
38959972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 23 - 103
Target Start/End: Complemental strand, 15354493 - 15354412
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||| |
|
|
| T |
15354493 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaacaat |
15354412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 21684374 - 21684294
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
21684374 |
acactttgtttt-gattgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
21684294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 38882445 - 38882525
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
38882445 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
38882525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 39798387 - 39798470
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||||| |
|
|
| T |
39798387 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaaattgttattggtgtgatttttcatcgaattcgcaacaat |
39798470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 23 - 101
Target Start/End: Complemental strand, 23741776 - 23741697
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
23741776 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaaca |
23741697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 25921387 - 25921336
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25921387 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
25921336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 31179294 - 31179213
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
31179294 |
acactttgtttt-ggttgcttaattatcccttgctccatacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
31179213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 4236985 - 4237065
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||| |||| | || |||||||||| |
|
|
| T |
4236985 |
acactttgtttt-ggttgcttgattatctcttgcttcacacatcaagttgttattggtgtgattttcaacgaattcacaaca |
4237065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 10529020 - 10528955
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
10529020 |
acactttgattttggttgcctgattatcccttgcttcacacatcaagttgttattggtgtgatttt |
10528955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 21948393 - 21948450
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21948393 |
tttttggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgtttt |
21948450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 36402253 - 36402168
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||||| |
|
|
| T |
36402253 |
acactttgattttggttgcctgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaacaat |
36402168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 25804381 - 25804440
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25804381 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtg |
25804440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 18469366 - 18469448
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| || ||||| |||| |||||||||| |
|
|
| T |
18469366 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtatgatttttcatcgaattcacaaca |
18469448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 10587172 - 10587252
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagtt-gttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||| |||||||||||| |||| |||| |||||||||| |
|
|
| T |
10587172 |
acactttgtttt-ggttgcttgattatcc-ttgctccacacatcaagtttgttattggtgtgattttcatcgaattcacaaca |
10587252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 18467041 - 18467126
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||| |||||||| ||||| ||||| |||| ||||||||||||| |
|
|
| T |
18467041 |
acactttgtttt-gattgcttgattatcccttgctccacacatcaagtttgttattagtgtgatttttcatcgaattcacaacaatt |
18467126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 27910798 - 27910875
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| || |||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
27910798 |
ttttggttgattgattatcccttgctccacacatcaaatttgttattggtgtgatttttcatcgaattcacaacaatt |
27910875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 41585662 - 41585578
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| |||||||||||| |||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
41585662 |
acactttgtttt-ggttgcttgattatctcttgccccacacatcaagtttgttattggtgtgatttttcatcgaattcacaacaat |
41585578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 20 - 90
Target Start/End: Complemental strand, 2818260 - 2818189
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcg |
90 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
2818260 |
acactttgattttggatgcctgattatcccttgctccatacatcaagtttgttattggtgtgtttttcatcg |
2818189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 6747666 - 6747725
Alignment:
| Q |
26 |
tgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
6747666 |
tgtttttggttgcttgattatctcttgctctacacatcaagtttgttattggtgtgtttt |
6747725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 17818417 - 17818352
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
17818417 |
acactttgtttt-ggttgcttgattattccttgctccacacatcaagtttgttattggtgtggtttt |
17818352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 34530633 - 34530559
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||| |||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
34530633 |
ttttggttgcttgattatcacttgctcgacacatcaagtttgttattggtgtgatttttcatcgaattcacaaca |
34530559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 99
Target Start/End: Original strand, 27912893 - 27912973
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaa |
99 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||| | ||||| |||| |||||||| |
|
|
| T |
27912893 |
acactttgtttt-ggttgcttgattatcccttactccacacatcaagtttgttattggtgggatttttcatcgaattcacaa |
27912973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 15552603 - 15552685
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| || ||| ||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
15552603 |
acactttgttttag-ttgcttgattatcccttacttcacgcatcaagttgttattggtgtgattttttcatcgaattcacaaca |
15552685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 24127208 - 24127292
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||| ||| |||||||| ||||| ||||| |||| ||||||||||| |
|
|
| T |
24127208 |
acactttgttttttgttgtctgattatcccttgctccacacattaagtttgttatttgtgtgatttttcatcgaattcacaacaa |
24127292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 658285 - 658204
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||| ||||||| |||||||||||||||| || |||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
658285 |
acactttgtttt-ggttgcctgattattccttgctccacacatcaaatttgttattggtgtgattttcatcgaattcgcaaca |
658204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 2724245 - 2724310
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||| |||| |
|
|
| T |
2724245 |
acactttgtttt-ggttgcttgattatcccttgctatacacatcaagtttgttattggtgtgatttt |
2724310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 28 - 104
Target Start/End: Original strand, 6745432 - 6745510
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||| ||||||| |||| |||||||||||||||||| |||||||||||||||||| | |||| |||| |||||||| |
|
|
| T |
6745432 |
tttttggctgcttgactatctcttgctccacacatcaagtttgttattggtgtgttttctcatcgaattcgcaacaatt |
6745510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 28 - 104
Target Start/End: Complemental strand, 20505762 - 20505684
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||| | || | ||||||||||||| |
|
|
| T |
20505762 |
tttttggttgcctgattattacttgctccacacatcaagtttgttattggtgtgttttctcattgaattcacaacaatt |
20505684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 21289111 - 21289176
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
21289111 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgatattggtgtgatttt |
21289176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 40221881 - 40221946
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
40221881 |
acactttgtttt-ggttgcttgactatcctttgctccacacatcaagtttgttattggtgtgatttt |
40221946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 1189526 - 1189454
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||| ||| |||||||||| |||| |||| |||||||||| |
|
|
| T |
1189526 |
ttttggtggcttgattattccttgctccacacatcaagtttgatattggtgtg-ttttcatcgaattcacaaca |
1189454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 26098213 - 26098153
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| ||| |||||||||| |
|
|
| T |
26098213 |
acactttgtttt-ggttgcttgattattccttgctccacacatcaagtttgatattggtgtg |
26098153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 80
Target Start/End: Original strand, 31545454 - 31545499
Alignment:
| Q |
35 |
ttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
31545454 |
ttgcttgattaacccttactccacacatcaagttgttattggtgtg |
31545499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 36208925 - 36209009
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||| |||||||||| || |||||| |||| ||||| |||| |||||||||||| |
|
|
| T |
36208925 |
acactttgtttt-ggttgcttgattatcacttgctctacacatcaagtttattattgatgtgatttttcatcgaattcacaacaat |
36209009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 37705701 - 37705644
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
37705701 |
ttttggttgcttggttattccttgctccacacatcaagtttgttattggtgtggtttt |
37705644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 12555832 - 12555780
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
12555832 |
ttttggttgcttgattattccttgctccacacatcaaatttgttattggtgtg |
12555780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 6756844 - 6756909
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag--ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| | |||| |||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6756844 |
acactttgtttt-gattgcctgattatcacttgctccacacatcaagttttgttattggtgtgtttt |
6756909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 39854838 - 39854921
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||||||||| |||||| || ||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
39854838 |
acactttatttttggttgcttaactatcccttgctccacatatcaagtttattattggtgtgatttttcatcgaattcgcaaca |
39854921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 16776512 - 16776577
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| | |||| ||||||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
16776512 |
acactttgtttt-gattgcctgattattccttgctccacacatcaagtttgttattggtgtgatttt |
16776577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 18511138 - 18511053
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||||||||||||| ||||||||| |||| ||| | |||| |||| |||||||| |
|
|
| T |
18511138 |
acactttgttttag-ttgcttgactatcccttgctccacacatcaagtttgttattgatgtgatttatcatcgaattcgcaacaatt |
18511053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 20054185 - 20054266
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||| ||||||||||| | ||||| ||||| |||| |||| |||||||||| |
|
|
| T |
20054185 |
acactttgtttt-ggttgcttgattattacttgctctacacatcaagtattttattagtgtgatttttatcgaattcacaaca |
20054266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 31465916 - 31465850
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||| |||||||||| || |||||||||||||| |||| |
|
|
| T |
31465916 |
acactttgattttggttgcttaattattccttgttccacacatcaaatttgttattggtgtgatttt |
31465850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 30 - 101
Target Start/End: Complemental strand, 16092118 - 16092045
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||| ||||| |||||||||| |||||| |||||||||||| ||||| | |||| |||||||||| |
|
|
| T |
16092118 |
tttggttgcttgactatccattgctccacatatcaagtttgttattggtgcgttttctcatcgaattcacaaca |
16092045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 26098083 - 26098127
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaa |
65 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26098083 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaa |
26098127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 29 - 100
Target Start/End: Complemental strand, 6661110 - 6661038
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaac |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| | | | ||||||||| |||| |||| ||||||||| |
|
|
| T |
6661110 |
ttttggttgcttgattattacttgctccacacatcaaatatttaattggtgtgattttcatcgaattcacaac |
6661038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 10474250 - 10474203
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagtt |
68 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
10474250 |
acactttgtttt-ggttacttgattattccttgctccacacatcaagtt |
10474203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 696226 - 696284
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggt |
77 |
Q |
| |
|
||||||| |||| | || |||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
696226 |
acactttattttggttttcttgattatctcttgctccacacatcaagtctgttattggt |
696284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 20045338 - 20045395
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggt |
77 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
20045338 |
acactttgtttt-ggttgcttgattatcatttgcttcacacatcaagtttgttattggt |
20045395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 2954767 - 2954831
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| ||||| |||||||| ||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
2954767 |
acactttgtttt-ggttgtctgattatcacttactccacacatcaaatttgttattggtgtgtttt |
2954831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 17073239 - 17073322
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgtttt-tgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| | ||||||||| ||| ||||||||||||||| || || |||||||||| |||| ||||| ||||||||||| |
|
|
| T |
17073239 |
acactttgttttag-ttgcttgatcatcacttgctccacacatcaaatttattattggtgtattttcggatcgaattcacaacaa |
17073322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 20 - 64
Target Start/End: Complemental strand, 18509244 - 18509201
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatca |
64 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
18509244 |
acactttgtttt-ggttgtttgactatcccttgctccacacatca |
18509201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 3e-28; HSPs: 76)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 11168438 - 11168522
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
11168438 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaatt |
11168522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 456253 - 456328
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
456253 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaatt |
456328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 29 - 103
Target Start/End: Original strand, 458630 - 458704
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
458630 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaat |
458704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 747095 - 747177
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
747095 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
747177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 10955947 - 10955862
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaattat |
106 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||| |||| |
|
|
| T |
10955947 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacatttat |
10955862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 10084309 - 10084229
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
10084309 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcggattcgcaaca |
10084229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 10958243 - 10958160
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
10958243 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaatt |
10958160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 27 - 104
Target Start/End: Complemental strand, 10621441 - 10621363
Alignment:
| Q |
27 |
gtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
10621441 |
gtttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaatt |
10621363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 6065715 - 6065630
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
6065715 |
acactttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaatt |
6065630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 10191232 - 10191152
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||| ||||| |
|
|
| T |
10191232 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcagattcgcaaca |
10191152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 22114224 - 22114143
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||| |||| ||||| |
|
|
| T |
22114224 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgctattggtgtgattttcatcgaattcgcaaca |
22114143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 41849390 - 41849470
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
41849390 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
41849470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 5191988 - 5192071
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||| |||| |
|
|
| T |
5191988 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaataatt |
5192071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 28412943 - 28412868
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgt-ttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
28412943 |
ttttggttacttgattatcccttgctccacacatcaagttgttattggtgtgttttttcatcgaattcacaacaat |
28412868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 5522547 - 5522461
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaattat |
106 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| | || |||| ||||| |||| |
|
|
| T |
5522547 |
acactttgattttggttgcttgactatcccttgctccacacatcaagttgttattggtgtgattttcaacgaattcgcaacatttat |
5522461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 106
Target Start/End: Original strand, 32219419 - 32219508
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg--tttttgatcggattcacaacaattat |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||| |||| ||||||||||||||| |
|
|
| T |
32219419 |
acactttgattttggttgcttgattatcccttgctccacacatcaagtttgttatttgtgtgattttttcatcgaattcacaacaattat |
32219508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 53893974 - 53893893
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||| |||||| |
|
|
| T |
53893974 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcgatcgaatttacaaca |
53893893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 25389244 - 25389327
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||| ||||||||||| |
|
|
| T |
25389244 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtatgattttttcatcgaattcacaacaa |
25389327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 23 - 80
Target Start/End: Original strand, 38890380 - 38890437
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38890380 |
ctttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
38890437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 7606524 - 7606441
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||| |||| ||| ||||||| |
|
|
| T |
7606524 |
acactttgattttggttgcttgactatctcttgctccacacatcaagttgttattggtgtatttttcatcgaatttgcaacaat |
7606441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 24980043 - 24980126
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| | |||| |||||||||| |
|
|
| T |
24980043 |
acactttgattttggttgcctgattatcccttgctccacacatcaagtttgttattggtgtgttttctcatcgaattcacaaca |
24980126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 3315017 - 3315103
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||| | |||| |||| |||||||| |
|
|
| T |
3315017 |
acactttgcttttggttgcttgattatcccttgctccacacatcaagtttattattggtgtgttttctcatcgaattcgcaacaatt |
3315103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 11170707 - 11170789
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||| |||| |||| |||| |||||| |
|
|
| T |
11170707 |
acactttgattttggttgcttgattatcccttactccacacatcaagttgttattaatgtgattttcatcgaattcgcaacaa |
11170789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 18099093 - 18099007
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
18099093 |
acactttgatttttgttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcccaacaatt |
18099007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 21 - 104
Target Start/End: Complemental strand, 28101930 - 28101845
Alignment:
| Q |
21 |
cactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgt-gtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
28101930 |
cactttgattttggttgcttgattatcccttgctccacacatcaagtttattattggtgtaatttttcatcgaattcacaacaatt |
28101845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 42990636 - 42990720
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
42990636 |
acactttgtttt-ggttgcctgattatcccttgctccacacatcaagtttgttattggtgtgattttcatcgaattcgcaacaatt |
42990720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 50494344 - 50494417
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
50494344 |
ttttggttgcttaattatctcttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
50494417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 43226422 - 43226498
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| | |||| |||| |||||||| |
|
|
| T |
43226422 |
ttttggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttctcatcgaattcgcaacaatt |
43226498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 43228624 - 43228683
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43228624 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtg |
43228683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 1321816 - 1321898
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
1321816 |
acactttgtttt-ggttgcctgattatcccttgctccacacatcaagtttgttattggtgtgattttcatcgaattcgcaacaa |
1321898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 5886544 - 5886599
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5886544 |
tttggttgcttgtttatcccttgctccacacatcaagttgttattggtgtgatttt |
5886599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 30 - 85
Target Start/End: Original strand, 5900017 - 5900072
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5900017 |
tttggttgcttgtttatcccttgctccacacatcaagttgttattggtgtgatttt |
5900072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 105
Target Start/End: Original strand, 25533762 - 25533846
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatta |
105 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||| ||||| |||| |||| ||||||||| |
|
|
| T |
25533762 |
acactttgtttt-ggttgcttgat-atctcttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaatta |
25533846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 23 - 103
Target Start/End: Complemental strand, 6063362 - 6063281
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
||||| |||||||||||| ||||||||||| |||||||||||||||||||| |||||| ||||| |||| |||| ||||||| |
|
|
| T |
6063362 |
ctttgattttggttgcttaattatcccttgttccacacatcaagttgttatcggtgtgatttttcatcgaattcgcaacaat |
6063281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 38210716 - 38210789
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| ||| ||||| |||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
38210716 |
ttttgtttgtttgataatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
38210789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 101
Target Start/End: Complemental strand, 9604519 - 9604447
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
9604519 |
tttggttacttgattattccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaaca |
9604447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 18096823 - 18096763
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgt |
79 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18096823 |
acactttgattttggttgcctgattatcccttgctccacacatcaagtttgttattggtgt |
18096763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 33 - 101
Target Start/End: Original strand, 36957651 - 36957719
Alignment:
| Q |
33 |
ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | || |||| |||| ||||| |||| |
|
|
| T |
36957651 |
ggttgcttgattatcccttgctccacacatcaagttgttattgatatgattttcatcgaattcagaaca |
36957719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 51726927 - 51726844
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||| ||||||| | |||| |||||||||||||||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
51726927 |
acactttgattttggttgcctgattattc-ttgccccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaatt |
51726844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 31151673 - 31151755
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
31151673 |
acactttgtttt-ggttgcttgattattacttgctccacacatcaagtatttattggtgtgatttttcatcgaattcacaacaa |
31151755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 1626608 - 1626543
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
1626608 |
acactttgtttttg-ttgcttgattattccttgctccacacatcaagtttgttattggtgtggtttt |
1626543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 27635580 - 27635515
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
27635580 |
acactttgtttt-ggttgcttgattattccttgctccacacatcaagtttgttattggtgtgatttt |
27635515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 1313739 - 1313799
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1313739 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgttattggtgtg |
1313799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 3307092 - 3307176
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag--ttgttattggtgtgtttt-tgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| || |||||||| |||||||||||||||||| | |||| |||||||||| |
|
|
| T |
3307092 |
acactttgtttttgattgtttgattatcccttgcttcatacatcaagttttgttattggtgtgttttctcatcgaattcacaaca |
3307176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 3859848 - 3859931
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||| | |||||||| ||||||||||||||||||||||||||| |||| ||||| ||||||||||| |
|
|
| T |
3859848 |
acactttgtttt-ggttgcttaactatcccttattccacacatcaagttgttattggtgtgacttttcgatcgaattcacaacaa |
3859931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 4308204 - 4308145
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||| | |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4308204 |
acactttgtttt-ggttgttggattattccttgctccacacatcaagttgttattggtgtg |
4308145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 27101104 - 27101045
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||| ||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
27101104 |
acactttgtttt-ggttgcctgattattcattgctccacacatcaagttgttattggtgtg |
27101045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 36 - 101
Target Start/End: Original strand, 15781226 - 15781293
Alignment:
| Q |
36 |
tgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt-gatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
15781226 |
tgcttgattatcccttactccacacatcaagtttgttattggtgtgtttttccatcgaattcacaaca |
15781293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 31 - 102
Target Start/End: Original strand, 25635718 - 25635789
Alignment:
| Q |
31 |
ttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| ||||| |||| |||| ||||||||||| |
|
|
| T |
25635718 |
ttggttgcttgattattacttgctccacacatcaagtatttattagtgtgattttcatcgaattcacaacaa |
25635789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 36012161 - 36012243
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
36012161 |
acactttgtttt-ggttgtttgattatcccttgctccatacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
36012243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 42992718 - 42992800
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||| |||||||||| |||||||| ||||| |||| |||| ||||||||||| |
|
|
| T |
42992718 |
acactttgtttt-ggttgtctgattatcccttgctctacacatcaagtttgttattagtgtgattttcatcgaattcacaacaa |
42992800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 18162997 - 18163083
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||||||||||| || || ||||||||||| ||||| |||| ||||| ||||||| |
|
|
| T |
18162997 |
acactttgattttggttgcctgattatcccttactccacacatcaaatttattattggtgtgatttttcatcgaattcataacaatt |
18163083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 28761361 - 28761287
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| || ||||||||||| ||||| |||| |||||||||| |
|
|
| T |
28761361 |
ttttggttgtttgattatcacttgctccacacatcaagattattattggtgtgatttttcatcgaattcacaaca |
28761287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 43423390 - 43423305
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaa-gttgttattggtgt-gtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
43423390 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaactttgttattggtgtaatttttcatcgaattcgcaacaatt |
43423305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 45883275 - 45883340
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
45883275 |
acactttgtttt-ggttgcttaactatcccttgctccacacatcaagtttgttattggtgtgatttt |
45883340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 53915412 - 53915338
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
53915412 |
ttttggttgcttgactatcccttgctccatacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
53915338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 53917588 - 53917523
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
53917588 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgttattagtgtgatttt |
53917523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 29 - 102
Target Start/End: Complemental strand, 54691490 - 54691416
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttt-tgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| || ||||||||| |||||||| | |||| ||||||||||| |
|
|
| T |
54691490 |
ttttggttgcctgattatcacttgctccacacataaatttgttattgatgtgttttctcatcgaattcacaacaa |
54691416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 23633781 - 23633865
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||| || |||||| |||||||| ||| ||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
23633781 |
acactttgtttt-ggttgcttgattttcacttgcttcacacatctagtatttattggtgtgatttttcatcgaattcacaacaatt |
23633865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 25634224 - 25634297
Alignment:
| Q |
31 |
ttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| |||| ||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
25634224 |
ttggttgcttgattattacttgctccccacattaagtatttattggtgtgattttcatcgaattcacaacaatt |
25634297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 65
Target Start/End: Original strand, 26720884 - 26720928
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaa |
65 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26720884 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaa |
26720928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 51943704 - 51943752
Alignment:
| Q |
19 |
aacactttgtttttggttgcttgattatcccttgctccacacatcaagtt |
68 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51943704 |
aacactttgtttt-ggttgcttgactatcccttgctccacacatcaagtt |
51943752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 30 - 85
Target Start/End: Complemental strand, 51674682 - 51674626
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
51674682 |
tttggttgcttgattattccttgctccatacatcaagtttgttattggtgtgatttt |
51674626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 53591523 - 53591579
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||||||| |||||||| |
|
|
| T |
53591523 |
ttttggttgcttgattatcccttgttccacacatcaaatttgttattgatgtgtttt |
53591579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 6484690 - 6484773
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| |||||||||||| ||||| |||||||||||||||| || |||||||| ||||| ||||| || | |||||||||| |
|
|
| T |
6484690 |
acactttgattttggttgcttaattattccttgctccacacatcaaatttgttattagtgtgattttttattgaattcacaaca |
6484773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 28181336 - 28181417
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||| |||||| ||| ||||||||||||||||| |||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
28181336 |
acactttgtttt-ggttgtttgattgtcc-ttgctccacacatcaagtttgttattggtgtgatttttgttcgaattcacaaca |
28181417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 880378 - 880313
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| ||||||| |||||| |||| |
|
|
| T |
880378 |
acactttgtttt-ggttgcttgattaatccttgctccacacatcaagtttgttatgggtgtgatttt |
880313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 25688083 - 25688022
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||| ||||||||| |||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
25688083 |
acactttgattttggttgtctgattatcacttgctccacacataaagtttgttattggtgtg |
25688022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 43421342 - 43421258
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaa-gttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||||| |
|
|
| T |
43421342 |
acactttgtttt-ggttgcttgactatatcttgctccacacatcaactttgttattggtgtgatttttcatcgaattcgcaacaat |
43421258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 53597575 - 53597647
Alignment:
| Q |
31 |
ttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| | ||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
53597575 |
ttggttgcttgattatt--ttgctccacacataaagtattttattggtgtgattttcatcgaattcacaacaatt |
53597647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 17795595 - 17795669
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| || || ||||||||||| ||||| |||| |||||||||| |
|
|
| T |
17795595 |
ttttggttgcttgactatcagttgctccacacatcaaatttattattggtgtgatttttcatcgaattcacaaca |
17795669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 19104035 - 19104109
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| || || ||||||||||| ||||| |||| |||||||||| |
|
|
| T |
19104035 |
ttttggttgcttgactatcagttgctccacacatcaaatttattattggtgtgatttttcatcgaattcacaaca |
19104109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 30 - 90
Target Start/End: Complemental strand, 561696 - 561635
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcg |
90 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| | ||||||||||| |||| |||| |
|
|
| T |
561696 |
tttggttgcttgattattacttactccacacatcaagtattttattggtgtgattttcatcg |
561635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 42 - 79
Target Start/End: Complemental strand, 35917937 - 35917900
Alignment:
| Q |
42 |
attatcccttgctccacacatcaagttgttattggtgt |
79 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
35917937 |
attatcccttgttccatacatcaagttgttattggtgt |
35917900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 36871222 - 36871147
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||| |||| |||||| ||||| | || |||||||||||| |
|
|
| T |
36871222 |
ttttggttgcttgattattc-ttgctccacacatcaagtatttatcggtgtgattttttcaacgaattcacaacaat |
36871147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 12267901 - 12267842
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgt |
79 |
Q |
| |
|
|||||||||||| |||||||||| ||| || ||||||||||||| || ||||||||||||| |
|
|
| T |
12267901 |
acactttgtttt-ggttgcttgactattccctgctccacacatcaaatttgttattggtgt |
12267842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 63; Significance: 4e-27; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 14311 - 14230
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
14311 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaa |
14230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 4e-27; HSPs: 40)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 2628808 - 2628726
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
2628808 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaacaa |
2628726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 4816152 - 4816071
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
4816152 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttgatcagattcacaaca |
4816071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 23 - 104
Target Start/End: Original strand, 33309251 - 33309332
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
33309251 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaatt |
33309332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 5273138 - 5273055
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
5273138 |
acactttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttttcatcgaattcacaaca |
5273055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 8717268 - 8717192
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
8717268 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaatt |
8717192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 26932484 - 26932399
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatta |
105 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
26932484 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcaaattcacaacaatta |
26932399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 23 - 101
Target Start/End: Original strand, 33311520 - 33311598
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
33311520 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaaca |
33311598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 29754622 - 29754549
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
29754622 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
29754549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 26068308 - 26068232
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
26068308 |
ttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaatt |
26068232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 11982953 - 11982871
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
11982953 |
acactttgtttt-ggttgcttgattattccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaa |
11982871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 23 - 101
Target Start/End: Complemental strand, 12195433 - 12195354
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
12195433 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
12195354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 28241243 - 28241162
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
28241243 |
acactttgtttt-gattgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaa |
28241162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 18322485 - 18322549
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18322485 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttt |
18322549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 19704487 - 19704426
Alignment:
| Q |
20 |
acactttg-tttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19704487 |
acactttgatttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
19704426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 29 - 101
Target Start/End: Complemental strand, 26066034 - 26065961
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
26066034 |
ttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
26065961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 14507098 - 14507039
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14507098 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
14507039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 1230162 - 1230088
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| |||| |||| ||||||| |
|
|
| T |
1230162 |
ttttggttgcttgattatctcttgatccacacatcaagttgttattggtgtgatttttatcgaattcgcaacaat |
1230088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 20915278 - 20915197
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| |||||||||||||| ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
20915278 |
acactttgtttt-ggttgcttgattaccccttgccccacacatcaagttattattggtgtgatttttgatcagattcacaaca |
20915197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 23 - 85
Target Start/End: Original strand, 26065376 - 26065438
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26065376 |
ctttgattttggttgcttgactatcccttgctccacacatcaagttgttattggtgtgatttt |
26065438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 23 - 85
Target Start/End: Original strand, 26085345 - 26085407
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26085345 |
ctttgattttggttgcttgactatcccttgctccacacatcaagttgttattggtgtgatttt |
26085407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 3629793 - 3629711
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||| | |||| |||||||||| |
|
|
| T |
3629793 |
acactttgtttt-ggttgcttgattatcctttgctccacacatcaagtttgttattggtgtgttttctcatcgaattcacaaca |
3629711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 3394754 - 3394840
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| || ||||||||||||||| | |||| |||| |||||||| |
|
|
| T |
3394754 |
acactttgtttttggttgcttgattatccatttctccacacatcaagatttttattggtgtgttttctcatcgaattcgcaacaatt |
3394840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 15367416 - 15367499
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||| | |||||||||||||||| |||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
15367416 |
acactttgtttt-ggttgcttgattatcacatgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaacaa |
15367499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 30034517 - 30034446
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||| |||| |||| |||| |||||| |
|
|
| T |
30034517 |
tttggttgcttgattatcc-ttgctccatacatcaagttgttattggtgtgattttcatcgaattcgcaacaa |
30034446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 30967601 - 30967657
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30967601 |
ttttggttacttgattatctcttgctccacacatcaagttgttattggtgtgatttt |
30967657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 24338377 - 24338292
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||| |||| |||||||||||||||||| ||||||||| |||| ||||| |||| ||||||||||||| |
|
|
| T |
24338377 |
acactttgtttt-ggttgcttgactatctcttgctccacacatcaagtttgttattgatgtgatttttcatcgaattcacaacaatt |
24338292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 13057587 - 13057659
Alignment:
| Q |
31 |
ttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
13057587 |
ttggttgcttgattatcctttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
13057659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 14458689 - 14458606
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||| |||||||||| ||||||||| || |||||||||||||| | ||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
14458689 |
acactttgattttggttgcctgattatccattactccacacatcaagctattattggtgtgatttttcatcgaattcgcaacaa |
14458606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 15346739 - 15346814
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||| |||||||||||||| ||||| |||| ||| ||||||| |
|
|
| T |
15346739 |
ttttggttgcttgattatcacttgttccacacatcaagtttgttattggtgtgatttttcatcgaatttacaacaa |
15346814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 3631866 - 3631781
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||| | |||||| |||||||||||| ||||| |||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
3631866 |
acactttgtttt-ggttgcctaattatcacttgctccacacgtcaagtttgttattggtgtgttttttcatcgaattcacaacaatt |
3631781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 30728751 - 30728686
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
30728751 |
acactttgtttt-ggttgtttgactatcccttgctccacacatcaagtttgttattggtgtgatttt |
30728686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 29 - 99
Target Start/End: Original strand, 22491005 - 22491077
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaa |
99 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| ||| |||||||||||||| ||||| |||| |||||||| |
|
|
| T |
22491005 |
ttttggttgcttgattatccttagctccacacattaagtttgttattggtgtgatttttcatcgaattcacaa |
22491077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 9020316 - 9020398
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
9020316 |
acactttgtttt-ggttgtctgattatctcttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
9020398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 17012420 - 17012505
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||| | |||||| |||| ||||| |||| ||||||||||||| |
|
|
| T |
17012420 |
acactttgtttt-ggttgcttgattattatttgctccacacatcaagtattttattgttgtgatttttcatcgaattcacaacaatt |
17012505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 29 - 77
Target Start/End: Complemental strand, 15541064 - 15541015
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggt |
77 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15541064 |
ttttggtttcttgactatcccttgctccacacatcaagtttgttattggt |
15541015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 21 - 84
Target Start/End: Complemental strand, 3233649 - 3233585
Alignment:
| Q |
21 |
cactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtgtttt |
84 |
Q |
| |
|
||||||| |||||||||| |||||||| ||| ||||||||||| || ||||||||| |||||||| |
|
|
| T |
3233649 |
cactttgattttggttgcctgattatcacttactccacacatcaaatttgttattgatgtgtttt |
3233585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 31 - 101
Target Start/End: Original strand, 32280391 - 32280463
Alignment:
| Q |
31 |
ttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||||||| |||||||| ||||| ||||| |||| |||||||||| |
|
|
| T |
32280391 |
ttggttgcttgattatcacttactccatacatcaagtttgttatttgtgtgattttttatcgaattcacaaca |
32280463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 25465513 - 25465441
Alignment:
| Q |
31 |
ttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||| | ||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
25465513 |
ttggttgcttgattatt--ttgctccatacatcaagtattttattggtgtgattttcatcgaattcacaacaatt |
25465441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 25480273 - 25480347
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||||||||| || |||||||| ||| ||||||||| | ||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
25480273 |
ttttggttgctcgactatcccttactctacacatcaaatatttattggtgtgatttttcatcgaattcacaacaa |
25480347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 46 - 103
Target Start/End: Original strand, 10584355 - 10584415
Alignment:
| Q |
46 |
tcccttgctccacacatcaag-ttgttattggtgtg--tttttgatcggattcacaacaat |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| | |||| |||||||||||| |
|
|
| T |
10584355 |
tcccttgctccacacatcaagtttgttattggtgtggttttctcatcgaattcacaacaat |
10584415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 2e-26; HSPs: 66)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 38394353 - 38394437
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
38394353 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaatt |
38394437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 20297729 - 20297813
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
20297729 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaatt |
20297813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 28485940 - 28486016
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
28485940 |
ttttggttgcttgattatcccttgctccacatatcaagttgttattggtgtgatttttcatcgaattcacaacaatt |
28486016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 9027115 - 9027034
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
9027115 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaaca |
9027034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 23 - 104
Target Start/End: Original strand, 40550198 - 40550280
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
40550198 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaacaatt |
40550280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 1606754 - 1606827
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
1606754 |
ttttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
1606827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 7471902 - 7471838
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7471902 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttt |
7471838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 25542903 - 25542976
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||||||| |
|
|
| T |
25542903 |
ttttgattgcttgattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaca |
25542976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 28487920 - 28487984
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28487920 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgatttt |
28487984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 40946697 - 40946777
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| || | |||| |||||||||| |
|
|
| T |
40946697 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattgatgtgattctcatcgaattcacaaca |
40946777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 48458020 - 48458100
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
48458020 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
48458100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 35996 - 36055
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35996 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
36055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 1850348 - 1850407
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1850348 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
1850407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 2935644 - 2935716
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||| |||| |||||||||| |
|
|
| T |
2935644 |
ttttggttgcttaattatcccttgcttcacacatcaagttgttattggtgtgattttcatcgaattcacaaca |
2935716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 29 - 106
Target Start/End: Complemental strand, 7349191 - 7349112
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaacaattat |
106 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||| |||| ||||||||||||||| |
|
|
| T |
7349191 |
ttttggttgcttaattatcccttactccacacatcaagttgttattggtgtgattttttcatcgaattcacaacaattat |
7349112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 7351573 - 7351488
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg--tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
7351573 |
acactttgtttt-ggttgcttaattatcccttactccacacatcaagttgttattggtgtgattttttcatcgaattcacaacaatt |
7351488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 11759494 - 11759576
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
11759494 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaa |
11759576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 20 - 95
Target Start/End: Original strand, 38397006 - 38397080
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattc |
95 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||| |||| |
|
|
| T |
38397006 |
acactttgtttt-ggttgctttattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattc |
38397080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 1046841 - 1046775
Alignment:
| Q |
20 |
acactttgttttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1046841 |
acactttgttttttggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttt |
1046775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 20299827 - 20299908
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
20299827 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttttcatcaaattcacaaca |
20299908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 1049213 - 1049152
Alignment:
| Q |
20 |
acactttgttttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1049213 |
acactttgttttttggttgcttgattatctcttgctccacacatcaagttgttattggtgtg |
1049152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 34 - 103
Target Start/End: Complemental strand, 1502883 - 1502814
Alignment:
| Q |
34 |
gttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||| || | |||||||||||| |
|
|
| T |
1502883 |
gttgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcattgaattcacaacaat |
1502814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 40836665 - 40836601
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40836665 |
acactttgtttt-ggttgtttgattatcccttgctccacacatcaagttgttattggtgtgatttt |
40836601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 43253438 - 43253358
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
43253438 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaaattgttattggtgtgattttcatcgaattcgcaaca |
43253358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 44931 - 44990
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44931 |
acactttgtttt-ggttgcttgattatccattgctccacacatcaagttgttattggtgtg |
44990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 18345908 - 18345971
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18345908 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagttgttgttggtgtgtttt |
18345971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 23 - 101
Target Start/End: Original strand, 22137448 - 22137527
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
22137448 |
ctttgattttggttgcttaattatctcttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaaca |
22137527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 23 - 101
Target Start/End: Original strand, 40552475 - 40552554
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
40552475 |
ctttgattttggttgcttaattatctcttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaaca |
40552554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 9679421 - 9679486
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||| |||||||||| |||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9679421 |
acactttgattttggttgcctgattatcacttgctccacacatcaagtttgttattggtgtgtttt |
9679486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 20626408 - 20626481
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
20626408 |
ttttggttgcttgattatctcttgctccacacatcaggttgttattggtgtgatttttcatcgaattcgcaaca |
20626481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 20630299 - 20630372
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
20630299 |
ttttggttgcttgattatctcttgctccacacatcaggttgttattggtgtgatttttcatcgaattcgcaaca |
20630372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 20642718 - 20642791
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
20642718 |
ttttggttgcttgattatctcttgctccacacatcaggttgttattggtgtgatttttcatcgaattcgcaaca |
20642791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 42223526 - 42223583
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
42223526 |
ttttggttgcttgattatcccttactccacacatcaagtttgttattggtgtgttttt |
42223583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 44724940 - 44725004
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44724940 |
acactttgtttt-ggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgtttt |
44725004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 7092127 - 7092051
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |||| ||| |||||||| |
|
|
| T |
7092127 |
ttttggttgcttgactatcccttgctccacacatcaagtttgttattggtgtgattttcatcgaatttgcaacaatt |
7092051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 7094374 - 7094298
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |||| |||| |||| |||||||| |
|
|
| T |
7094374 |
ttttggttgcttgactatgccttgctccacacatcaagtttgttattggtgtgattttcatcgaattcgcaacaatt |
7094298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 24748952 - 24749038
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg--tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||| |||||||||||||| ||| | |||| ||||||||||||| |
|
|
| T |
24748952 |
acactttgtttt-ggttgtttgattatcccttgctccacacatcaagtttgttattggtgtggttttctcatcgaattcacaacaatt |
24749038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 20 - 105
Target Start/End: Complemental strand, 13099399 - 13099313
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatta |
105 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||||||||||| |||||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
13099399 |
acactttgtttt-ggttgtttgacgatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcacaacaatta |
13099313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 21678424 - 21678509
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||| |||||| ||||||| |||||| ||||| |||| ||||||||||||| |
|
|
| T |
21678424 |
acactttgtttt-ggttgcttgattattccttgctccacaaatcaagtttgttatcggtgtgatttttcatcgaattcacaacaatt |
21678509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 22251512 - 22251448
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
22251512 |
acactttgtttt-ggttgtttgattatcccttgctcaacacatcaagtttgttattggtgtgtttt |
22251448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 3036091 - 3036150
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
3036091 |
acactttgtttt-ggttgcttgattatctcttgctccaaacatcaaattgttattggtgtg |
3036150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 7188896 - 7188982
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtg--tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| | |||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
7188896 |
acactttgtttt-ggttgcttgattattacttgctccacacatcaagtattttattgatgtgattttttgatcgaattcacaacaatt |
7188982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 20 - 68
Target Start/End: Original strand, 21990512 - 21990560
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagtt |
68 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21990512 |
acactttgattttggttgcctgattatcccttgctccacacatcaagtt |
21990560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 3878954 - 3879005
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||| |||| |
|
|
| T |
3878954 |
ttttggttgcttgattatctcttgctccacacatcaagttattattgatgtg |
3879005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 7469944 - 7469863
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| | |||||||||||||||| |||||||||||||| |||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
7469944 |
acactttgttttag-ttgcttgattatccct-gctccacacatcaaattgttattggtgtgatttttcatcgaattcgcaacaa |
7469863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 11355621 - 11355707
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg--tttttgatcggattcacaacaat |
103 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||||| || || ||||||||||| ||||| |||| |||| ||||||| |
|
|
| T |
11355621 |
acactttgtttttggttgcctgattattccttgctccacacatcaaatttattattggtgtgattttttcatcgaattcccaacaat |
11355707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 4295863 - 4295798
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
4295863 |
acactttgtttt-ggttgcttgatgattccttgctccacacatcaagtttgttattggtgtgatttt |
4295798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 23 - 69
Target Start/End: Original strand, 22108438 - 22108484
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttg |
69 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22108438 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttg |
22108484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 443960 - 444020
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
443960 |
acactttgtttt-ggttgcttgactattccttgctccacacatcaagtttgttattggtgtg |
444020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 27306158 - 27306098
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
27306158 |
acactttgtttt-ggttgcttgactatcccttgttccacacatcaagtttgttattggtgtg |
27306098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 85
Target Start/End: Complemental strand, 31434967 - 31434910
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
31434967 |
ttttgattgcttgattattccttgctccacacatcaagtttgttattggtgtgatttt |
31434910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 80
Target Start/End: Complemental strand, 37412049 - 37411989
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||||||||||| |||||||||||||| |
|
|
| T |
37412049 |
acactttgtttt-ggttgcttgattattccttgttccacacatcaagtttgttattggtgtg |
37411989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 42330928 - 42330881
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagtt |
68 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42330928 |
acactttgtttt-ggttgcttgattatccattgctccacacatcaagtt |
42330881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 21680390 - 21680472
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgt-gtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||||| ||||||||||| ||||||||||||| | |||| |||| |||||||||| |
|
|
| T |
21680390 |
acactttgtttttg-ttgcatgattattccttgcttcacacatcaagcttgttattggtgtgggttttcatcgaattcacaaca |
21680472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 108
Target Start/End: Original strand, 24465893 - 24465982
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg-tttttgatcggattcacaacaattatca |
108 |
Q |
| |
|
|||||||||||| |||||||||| |||| |||| |||||||||| || || ||||||||||| ||||| |||| ||||||||||| ||||| |
|
|
| T |
24465893 |
acactttgtttt-ggttgcttgaatatcacttgttccacacatcaaatttattattggtgtgatttttcatcgaattcacaacaactatca |
24465982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 21 - 101
Target Start/End: Original strand, 25276487 - 25276566
Alignment:
| Q |
21 |
cactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||| | ||||||||||||||| | ||| ||||||||||||||||||||||||||| ||||| | || |||||||||| |
|
|
| T |
25276487 |
cactttgatattggttgcttgattaac--ttgatccacacatcaagttgttattggtgtgattttttagcgaattcacaaca |
25276566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 20 - 84
Target Start/End: Original strand, 9681182 - 9681247
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
|||||||| ||||||||| | |||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
9681182 |
acactttgattttggttgtctaattatcacttgttccacacatcaagtttgttattggtgtgtttt |
9681247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 26804873 - 26804933
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatc-aagttgttattggtgtg |
80 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
26804873 |
acactttgtttt-ggttgcttgactatcctttgctccacacatcaaatttgttattggtgtg |
26804933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 29 - 77
Target Start/End: Complemental strand, 39145905 - 39145856
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggt |
77 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
39145905 |
ttttggttgcttgattatcacttactccacacatcaagtttgttattggt |
39145856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 29 - 65
Target Start/End: Complemental strand, 20137066 - 20137030
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaa |
65 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20137066 |
ttttggttgcttgactatcccttgctccacacatcaa |
20137030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 31 - 101
Target Start/End: Complemental strand, 24813419 - 24813348
Alignment:
| Q |
31 |
ttggttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| | |||||| |||| |||| |||| | |||||||| |
|
|
| T |
24813419 |
ttggttgcttgattattacttgctccacacatcaagtattttattgatgtgattttcatcgaactcacaaca |
24813348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 53 - 102
Target Start/End: Complemental strand, 31153740 - 31153690
Alignment:
| Q |
53 |
ctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||| |||| |||||| |
|
|
| T |
31153740 |
ctccacacatcaagttgttattggtgtgatttttcatcgaattcgcaacaa |
31153690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 6349155 - 6349239
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| || |||||| ||||||||||| |||||| || |||||||||||| |
|
|
| T |
6349155 |
acactttgtttt-ggttgcttgattattacttgctccatacgtcaagtatttattggtgtgagttttgaacgatttcacaacaatt |
6349239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 26295804 - 26295868
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| | ||||||||||||| | ||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
26295804 |
acactttgtttt-gattgcttgattatcacgtgctccatacatcaagtatttattggtgtgatttt |
26295868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 28 - 68
Target Start/End: Complemental strand, 21592064 - 21592024
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaagtt |
68 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
21592064 |
tttttggttgtctgattatcacttgctccacacatcaagtt |
21592024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 27832570 - 27832487
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| |||| ||||||||| | |||||||||||| ||| ||||||||||| || ||||| |||| ||||||||||| |
|
|
| T |
27832570 |
acactttgtttt-ggttacttgattatttcctgctccacacattaagtttgttattggtatgatttttcatcgaattcacaacaa |
27832487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0127 (Bit Score: 58; Significance: 4e-24; HSPs: 1)
Name: scaffold0127
Description:
Target: scaffold0127; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 12796 - 12712
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgt-gtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||| |
|
|
| T |
12796 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagttgttattggtgtcatttttcatcgaattcacaacaatt |
12712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 57; Significance: 2e-23; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 23 - 102
Target Start/End: Original strand, 6567 - 6647
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
6567 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcatcgaattcacaacaa |
6647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 57; Significance: 2e-23; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 3254 - 3322
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcaca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||| |
|
|
| T |
3254 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcaca |
3322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 55; Significance: 3e-22; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 23 - 104
Target Start/End: Original strand, 22485 - 22567
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
22485 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaacaatt |
22567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 23 - 102
Target Start/End: Original strand, 24760 - 24840
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaa |
102 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||| |
|
|
| T |
24760 |
ctttgattttggttgcttaattatcccttgctccacacatcaagttgttattggtgtgatttttcgtcgaattcacaacaa |
24840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 55; Significance: 3e-22; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 20 - 102
Target Start/End: Complemental strand, 41405 - 41324
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaa |
102 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
41405 |
acactttgtttt-gattgcttgattatctcttgctccacacatcaagttgttattggtgtgattttcatcgaattcacaacaa |
41324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0267 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold0267
Description:
Target: scaffold0267; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 23 - 80
Target Start/End: Original strand, 394 - 451
Alignment:
| Q |
23 |
ctttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
394 |
ctttgattttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 54; Significance: 1e-21; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 29536 - 29616
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||| ||||| |
|
|
| T |
29536 |
acactttgtttt-gattgcttgattatcccttgctccacacatcaagttgttattggtgtgattttcatcgaattcgcaaca |
29616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 53; Significance: 4e-21; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 29 - 108
Target Start/End: Complemental strand, 69206 - 69126
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttttgatcggattcacaacaattatca |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||| |||| |||||||||| |||||| |
|
|
| T |
69206 |
ttttggttgcctgattatcccttgctccacacatcaagtttgttattggtgtgattttcatcgaattcacaacagttatca |
69126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 51; Significance: 6e-20; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 50375 - 50460
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
50375 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaacaatt |
50460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 20 - 101
Target Start/End: Original strand, 52374 - 52456
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtg-tttttgatcggattcacaaca |
101 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |||| ||||| |
|
|
| T |
52374 |
acactttgtttt-ggttgcttgattatcccttgctccacacatcaagtttgttattggtgtgatttttcatcgaattcgcaaca |
52456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 33 - 80
Target Start/End: Complemental strand, 183551 - 183504
Alignment:
| Q |
33 |
ggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
183551 |
ggttgcttgattatctcttgctccacacatcaagttgttattggtgtg |
183504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 1374 - 1310
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1374 |
acactttgtttt-ggttgcttgattatctcttgctccacacatcaagttgttattggtgtgatttt |
1310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 49; Significance: 1e-18; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 20 - 79
Target Start/End: Original strand, 35956 - 36016
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgt |
79 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35956 |
acactttgtttttggttgcttgactatcccttgctccacacatcaagtttgttattggtgt |
36016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0891 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0891
Description:
Target: scaffold0891; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 34 - 103
Target Start/End: Complemental strand, 4586 - 4516
Alignment:
| Q |
34 |
gttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaat |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
4586 |
gttgcttgattatcccttactccacacatcaaattgttattggtgtgattttggatcagattcacaacaat |
4516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1674 (Bit Score: 46; Significance: 6e-17; HSPs: 1)
Name: scaffold1674
Description:
Target: scaffold1674; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 1373 - 1289
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg-tttttgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||| ||||| |||| |||||||| |||| |
|
|
| T |
1373 |
acactttgtttt-ggttgcttgattatctttttctccacacatcaagttgttattggtgtgatttttcatcgaattcacaaaaatt |
1289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 79548 - 79614
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| |||||||||| | ||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
79548 |
acactttgattttggttgcctaattatcccttgctccacacatcaagtttgttattggtgtgatttt |
79614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0468 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0468
Description:
Target: scaffold0468; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 30 - 104
Target Start/End: Complemental strand, 1564 - 1490
Alignment:
| Q |
30 |
tttggttgcttgattatcccttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| | ||||||||||| |||| || | ||||||||||||| |
|
|
| T |
1564 |
tttggttgcttgattattacttgctccacacatcaaatatttattggtgtgattttcattgaattcacaacaatt |
1490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 85590 - 85656
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgttttt |
85 |
Q |
| |
|
|||||||| ||||||||| ||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
85590 |
acactttgattttggttgtttgattatctcttgctccacacattaagattgttattggtgtgatttt |
85656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 80222 - 80308
Alignment:
| Q |
20 |
acactttgtttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt-tgatcggattcacaacaatt |
104 |
Q |
| |
|
|||||||| |||| ||||| ||||||| |||||||||||||||||| |||||||||||||||||| | |||| |||| |||||||| |
|
|
| T |
80222 |
acactttgattttcgttgcctgattattacttgctccacacatcaagtttgttattggtgtgttttctcatcgaattcgcaacaatt |
80308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1899 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold1899
Description:
Target: scaffold1899; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 41 - 85
Target Start/End: Original strand, 1 - 45
Alignment:
| Q |
41 |
gattatcccttgctccacacatcaagttgttattggtgtgttttt |
85 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1 |
gattatctcttgctccacacatcaagttgttattggtgtgatttt |
45 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 4363 - 4419
Alignment:
| Q |
29 |
ttttggttgcttgattatcccttgctccacacatcaag-ttgttattggtgtgtttt |
84 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| ||||||||| |||||||| |
|
|
| T |
4363 |
ttttgattgcttgattatcccttactccacacatcaagtttgttattgatgtgtttt |
4419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 11389 - 11337
Alignment:
| Q |
28 |
tttttggttgcttgattatcccttgctccacacatcaagttgttattggtgtg |
80 |
Q |
| |
|
||||| ||||||| ||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
11389 |
tttttcgttgcttaattattccttactccacacatcaagttgttattggtgtg |
11337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0256
Description:
Target: scaffold0256; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 50 - 104
Target Start/End: Original strand, 16605 - 16659
Alignment:
| Q |
50 |
ttgctccacacatcaagttgttattggtgtgtttttgatcggattcacaacaatt |
104 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
16605 |
ttgctccacgcatcaagtttttattggtgtgattttcatcgaattcacaacaatt |
16659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 34 - 101
Target Start/End: Complemental strand, 16569 - 16501
Alignment:
| Q |
34 |
gttgcttgattatcccttgctccacacatcaagt-tgttattggtgtgtttttgatcggattcacaaca |
101 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | |||||||| | |||| |||| |||||||||| |
|
|
| T |
16569 |
gttgcttgattattacttgctccacacatcaagtattttattggtataatttttatcgaattcacaaca |
16501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University