View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_low_12 (Length: 447)
Name: NF14285_low_12
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 28 - 195
Target Start/End: Complemental strand, 32886538 - 32886367
Alignment:
| Q |
28 |
tggcagctggggtttgtttcaggttgaagaagatagaccattgggctgtcatatttttaaacccgacccatttagcttgggctctctt----ttttaaca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
32886538 |
tggcagctggggtttgtttcaggttgaagaagatagaccattgggctgtcatatttttaaacccgacccatttagcttggcctctcttttttttttaaca |
32886439 |
T |
 |
| Q |
124 |
gttttaggacatgttcaagcaataaagggattttgacccacaataaaaaatgaatcaagttgtgatatatga |
195 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32886438 |
gatttaggacatgttcaagcaataaagggattttgacccacaataaaaaatgaatcaagttgtgatatatga |
32886367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 300 - 435
Target Start/End: Complemental strand, 32886260 - 32886123
Alignment:
| Q |
300 |
gagtaccaggtgaagatagggttgaacagttggaaaaactca--aattttaagttttggttaaaaattctaagtgagaaacaatattttcttaaaaatgt |
397 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
32886260 |
gagtaccaggtgaagatagtgttgaacagtttgaaaaactcataaattttatgttttggttaaaaattctaagtaagaaacaatattttcttaaaaattt |
32886161 |
T |
 |
| Q |
398 |
attgatagtttactatacttaaattaaatagtatgtga |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32886160 |
attgatagtttactatacttaaattaaatagtatgtga |
32886123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 419
Target Start/End: Original strand, 18141909 - 18141945
Alignment:
| Q |
383 |
ttttcttaaaaatgtattgatagtttactatacttaa |
419 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
18141909 |
ttttcataaaaatttattgatagtttactatacttaa |
18141945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University