View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_low_14 (Length: 420)
Name: NF14285_low_14
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 151 - 367
Target Start/End: Original strand, 44916166 - 44916379
Alignment:
| Q |
151 |
atgatgagaggaaacacactgcaacggaactaatcgagttgcaataagggaatctgactcagtccccaccttgtataattactagataacaatgcccctg |
250 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44916166 |
atgatgagaggaaacgcactgcaacggaactaatcgagttgcaataagggaatatgactcagtccccaccttgtataattactagataacaatgccccgg |
44916265 |
T |
 |
| Q |
251 |
agaatagccttaaattttgcttccaacactaccaatgaagctccaatgaaatcagtataaccaaaaggtttgctattatgtaactgtgatgtgagactaa |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44916266 |
agaatagccttaaattttgcttccaacact---aatgaagctccaatgaaatcagtataaccaaaaggtttgctattatgtaactgtgatgtgagactaa |
44916362 |
T |
 |
| Q |
351 |
atgagtttcacagcaat |
367 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44916363 |
atgagtttcacagcaat |
44916379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University