View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_low_19 (Length: 328)
Name: NF14285_low_19
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 27 - 213
Target Start/End: Complemental strand, 2088141 - 2087957
Alignment:
| Q |
27 |
aattatctttgaaggaaaaattgtgtagtgaacacaaaattgaacttgtagtggcaaattatatttcttttaaggcttgattgtgtatagctggacctct |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2088141 |
aattatctttgaaggaaaaattgtgtagtgaacacaaaattgaacttgtagtggcaaattatatttcttttaaggcttgattgtgtatagctggacctct |
2088042 |
T |
 |
| Q |
127 |
gatggttgttgtttcctaagaggcttaaggattttaagtcatttttacaagacatatgtactatagtcaagtttgcagaagtatatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2088041 |
gatggttgttgtttcctaagaggcttaaggattttaagtcatttttacaagac--atgtactatagtcaagtttgcagaagtatatg |
2087957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University