View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14285_low_34 (Length: 241)
Name: NF14285_low_34
Description: NF14285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14285_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 54 - 215
Target Start/End: Complemental strand, 39564254 - 39564093
Alignment:
| Q |
54 |
gcggatagacttttgataatgtgaggaaattattggaaacatttataattattgtcttatccttcataaaagaatattgtcttagtccctnnnnnnnntt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39564254 |
gcggatagacttttgataatgtgaggaaattattggaaacatttataattattgtcttatccttcataaaagaatattgtcttagtccctaaaaaaaatt |
39564155 |
T |
 |
| Q |
154 |
gtcttagtattctaaagtgaaaaataatataagatgaaaaactattttaaaagtgacacttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39564154 |
gtcttagtattctaaagtgaaaaataatataagatgaaaaactattttaaaagtgacacttg |
39564093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University