View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14286_low_3 (Length: 257)
Name: NF14286_low_3
Description: NF14286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14286_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 31384508 - 31384733
Alignment:
| Q |
20 |
tcatgttgtttttatttaataattatactttctagttctgcatatattaagtgattagttattggtctgttccttgcattaagtgttcagttattggtct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31384508 |
tcatgttgtttttatttaataattatactttctagttctgcatatattaagtgattagttattggtctgttccttgcattaagtgttcagttattggtct |
31384607 |
T |
 |
| Q |
120 |
gttccttgcatgatgatgatattgtggtaagctaacttggaagcttagaaatgtgtattgtggattttctcttcccttccctggttttgcaaacctctgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31384608 |
gttccttgcatgatgatgatattgtggtaagctaacttggaagcttagaaatgtgtattgtggattttctcttcccttccctggttttgcaaacctctgt |
31384707 |
T |
 |
| Q |
220 |
aatcttgtactgtttaatgttatttt |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31384708 |
aatcttgtactgtttaatgttatttt |
31384733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University