View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14287_low_11 (Length: 308)
Name: NF14287_low_11
Description: NF14287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14287_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 33 - 285
Target Start/End: Complemental strand, 36474942 - 36474693
Alignment:
| Q |
33 |
tattttcaaacaaaagaaaaatgtggttattatattttggaaggattacatcctaagtggtttgaattctccaaaccctaggtttgtgaagaattgttta |
132 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474942 |
tattttcaaacaaaagaaaaatatggttattatattttggaaggattacatg---agtggtttgaattctccaaaccctaggtttgtgaagaattgtttg |
36474846 |
T |
|
| Q |
133 |
atgctcttttgaagattgcctcacaatgagacccctgcaaccgttttacctcatatgtcagcgttccaagatgccatcaccatgttaatgagatctgaca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474845 |
atgctcttttgaagattgcctcacaatgagacccctgcaaccgttttacctcatatgtcagcgttccaagatgccatcaccatgttaatgagatctgaca |
36474746 |
T |
|
| Q |
233 |
atactcttgacatgcgcattgccacgctttttgctgctatcaacctccttcat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474745 |
atactcttgacatgcgcattgccacgctttttgctgctatcaacctccttcat |
36474693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University